1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hram777 [196]
3 years ago
9

What is the shape of DNA?

Biology
1 answer:
Sliva [168]3 years ago
8 0

Answer:

double helix

Explanation:

You might be interested in
Which brain structure receives information from all the senses except smell?
likoan [24]

The brain structure that receives information from all the senses except smell is the thalamus. This is located above the brain stem of the brain in which is a small structure that is responsible for having to receive or pass sensory signals to the brain’s cerebral cortex.

<span />
5 0
4 years ago
What are the three looped fluid-filled canals in the inner ear that detect the direction of the body's movement?
masya89 [10]

Answer:

The semicircular canals ( vestibular system)

Explanation:

The inner ear of humans is made up of two parts.

  • The cochlea which aid in the hearing process.
  • The vestibular system which aid for balance of the body

The vestibular system comprises of three fluid filled looped canals . The vestibular system comprises of sensory cells which detect even a slight tilting of the head. The fluid filled canals are termed as the semicircular canals. It is due to the vestibular system that we feel a room to bespinning even after we have finished our rotation ride.

4 0
3 years ago
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
erica [24]

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
5 0
3 years ago
How do biomass and energy flow through an ecosystem?
Svetllana [295]

Answer:

Productivity within an ecosystem can be defined as the percentage of energy entering the ecosystem incorporated into biomass in a particular trophic level. Biomass is the total mass, in a unit area at the time of measurement, of living or previously living organisms within a trophic level.

HOPE THIS HELPED!!!!!!!!!!!XDDD

3 0
3 years ago
My doctor told me that birth control pills contain small amounts of estrogen and progesterone, and these hormones prevent me fro
ser-zykov [4K]
Estrogen and progesterone stabilize a woman's natural <span>hormone levels, and prevent estrogen from peaking mid-cycle. Also a  high level of progesterone is maintained </span><span>which prevents secretions of FSH and LH. The result is that no new egg follicles are developed and no </span>ovulation occurs.
7 0
4 years ago
Read 2 more answers
Other questions:
  • Why is it important to detect an HIV infection as early as possible?
    14·2 answers
  • Which of the following is true of the light dependent reactions but not of the light independent reaction?
    7·1 answer
  • Does carbohydrate hydrolysis by ptyalin continue in the stomach
    6·1 answer
  • Sally's teacher asked her to classify a microscopic organism found in pond water. The FIRST characteristic Sally used to figure
    7·1 answer
  • Following glycolysis and the citric acid cycle, but before the electron transport chain and oxidative phosphorylation, the carbo
    8·1 answer
  • The botulinum toxin (or Botox) is one of the most lethal toxin to humans with a killing dose of 1 ng/kg of bodyweight. In order
    5·1 answer
  • A population of Muscovy ducks contains 13 birds with black masks and 37 birds with red masks. Red masks are the dominant trait.
    15·1 answer
  • A student drew a representation of the atoms of a solid. The illustration shows closely packed atoms vibrating, but remaining in
    9·1 answer
  • The resting potential of a resting neuron is caused by
    10·2 answers
  • Write 5 sentences about global warming​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!