1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
9966 [12]
3 years ago
13

State birth control methods according to Islam view?please help ​

Biology
1 answer:
Advocard [28]3 years ago
7 0

Answer:

The Qur'an does not refer to contraception explicitly, but Muslims opposed to birth control often quote the Qur'an as saying "

Explanation:

You should not kill your children for fear of want" (17:31, 6:151) and interpret this as including a ban on contraception as well as infanticide.

You might be interested in
Ninhydrin is used on a latent print to detect
oksano4ka [1.4K]
I think it is D I’m not sure
7 0
2 years ago
Which of the following is not a way in which biomes can change?Which of the following is not a way in which biomes can change?
denpristay [2]
The answer is solar eclipses
5 0
3 years ago
Read 2 more answers
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Defecation depends on
ASHA 777 [7]

Answer: the correct answer is d. all of the above must happen for defecation to occur.

Explanation:

In response to the distention of the rectal wall, the receptors send sensory nerve impulses to the sacral spinal cord. Motor impulses from the cord travel along parasympathetic nerves back to the descending colon, sigmoid colon, rectum, and anus. The resulting contraction of the longitudinal rectal muscles shortens the rectum, thereby increasing the pressure within it. This then opens the internal sphincter.

6 0
3 years ago
What Citric acid cyrcle
andrey2020 [161]

Answer:

series of chemical reactions used by all aerobic organisms to generate energy through the oxidation of acetate

Explanation:

The citric acid cycle, also known as the Krebs cycle or the tricarboxylic acid cycle, is at the center of cellular metabolism, playing a starring role in both the process of energy production and biosynthesis. It finishes the sugar-breaking job started in glycolysis and fuels the production of ATP in the process.

4 0
3 years ago
Other questions:
  • REALLY NEED HELP
    7·1 answer
  • Really need help with this Biology question:
    11·2 answers
  • A geneticist discovers an obese mouse in his laboratory colony. He breeds this obese mouse with a normal mouse. All the F1 mice
    12·1 answer
  • I’ll give brainliest.<br><br> What is the climate comparison between New Hampshire and Arizona?
    5·1 answer
  • The time it takes an object to go around another object (one year) is
    14·1 answer
  • What is the name of the gas, name given by Lavoisier, involved in the combustion of matter?
    8·1 answer
  • Marta wants to explain how pollution is affecting the biodiversity of a local lake. Which of the following models are the most a
    12·1 answer
  • As a commodity producer, the price that you receive is likely to be different than the price your neighbor receives for selling
    14·2 answers
  • Structures located at the ends of eukaryotic chromosomes are called ________. telomerases permissive mutations telomeres centrom
    9·1 answer
  • Where do the independent and dependent variable each appear on the graph
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!