I think it is D I’m not sure
        
             
        
        
        
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
 
        
             
        
        
        
Answer: the correct answer is d. all of the above must happen for defecation to occur.
Explanation: 
In response to the distention of the rectal wall, the receptors send sensory nerve impulses to the sacral spinal cord. Motor impulses from the cord travel along parasympathetic nerves back to the descending colon, sigmoid colon, rectum, and anus. The resulting contraction of the longitudinal rectal muscles shortens the rectum, thereby increasing the pressure within it. This then opens the internal sphincter.
 
        
             
        
        
        
Answer:
series of chemical reactions used by all aerobic organisms to generate energy through the oxidation of acetate
Explanation:
The citric acid cycle, also known as the Krebs cycle or the tricarboxylic acid cycle, is at the center of cellular metabolism, playing a starring role in both the process of energy production and biosynthesis. It finishes the sugar-breaking job started in glycolysis and fuels the production of ATP in the process.