1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Musya8 [376]
3 years ago
12

(GIVING BRAINLIEST!!)

Biology
2 answers:
kifflom [539]3 years ago
5 0

Answer:

D

Explanation:

frutty [35]3 years ago
5 0

i thinj it is iether b or d.

You might be interested in
The primary gases of the atmosphere are
8_murik_8 [283]

the top three are

-carbon dioxide

-oxygen

-nitrogen

6 0
3 years ago
The drug cytochalasin B blocks the function of actin. Which of the following aspects of the cell cycle would be most disrupted b
Sladkaya [172]

The correct answer is: E) cleavage furrow formation and cytokinesis

Cytochalasin B (cytos-cell and chalasis-relaxation) is a molecule which inhibit network formation by actin filaments by blocking monomer addition. As a result, itshortens actin filaments. This molecule is involved in cytoplasmic division where it blocks the formation of contractile microfilaments. One of the microfilament’s function includes cytokinesis and formation of cleavage furrow so these functions are affected by cytochalasin B.


7 0
3 years ago
Synthetic forms of the male hormone testosterone that are used to cause muscle hypertrophy are called _______
Greeley [361]
Anabolic steroids are synthetic forms of the male hormone testosterone that are used to cause muscle hypertrophy.

It is properly knowns as anabolic-androgenic steroids (AAS). They are anabolic in nature and increases the protein found within the cells especially in the skeletal muscles. It also has varying degrees of androgenic and virilizing effect which includes inducing the development and maintenance of male secondary sexual characteristics such as facial and hair body growth.

In the 1930s AAS were synthesized and are recently used as a therapeutic medicine to stimulate muscle growth, increase appetite, induce puberty in males and treat wasting conditions among cancer and AIDS patients. It was also acknowledged by the American College of Sports Medicine that AAS, when joined with an adequate diet, can contribute to increasing the body weight, often as lean mass increases and the gains in muscular strength are achieved by doing high-intensity workout and proper diet.


5 0
3 years ago
Read 2 more answers
How can an event that blocks sunlight from reaching earth cause a mass extinction of consumers on Earth?
anyanavicka [17]

B. Consumers depend on producers to make food using sunlight. This is the right option.

6 0
3 years ago
Read 2 more answers
What are the componenets of ribosomes
hammer [34]
The answer would be RNA and protein. Each subunit is composed of at least one or more rRNA molecules and proteins. 
7 0
3 years ago
Other questions:
  • Under most conditions, the supply of energy by catabolic pathways is regulated by the demand for energy by anabolic pathways. Co
    6·1 answer
  • When in england, darwin displayed a wide variety of physical symptoms. these symptoms were probably ___?
    15·1 answer
  • If mean global temperature keeps on increasing, which type of species will most likely go extinct? Generalist or specialist?
    13·1 answer
  • Which of these is composed of organic compounds?
    8·2 answers
  • What is the difference between sensory, motor and relay neurons?​
    7·1 answer
  • The messages that scientists are sending into space are directed at intelligent alien life. Do
    10·1 answer
  • Photosynthesis and cellular respiration both involve the use and release of gases. Which statement correctly identifies the role
    12·1 answer
  • What is the metric unit for measuring length?
    9·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which of these has not been used as an RNA probe?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!