The fusion of two parents' genetic material is understood as sexual reproduction while asexual reproduction yields genetically similar offspring to the same parent.
<u>Asexual Reproduction:</u>
This way all the prokaryotes and other eukaryotes produce offspring. There are a variety of different asexual reproductive practices. These comprises of binary, fragmentation, and budding fission.
- The binary fission appears when a parent cell wants to split into 2 separate daughter cells of the same diameter. For an instance, protozoa reproduces in the same way.
- Fragmentation happens when a parent entity divides into small parts or fragments, and each segment grows into a recent organism. Starfish, that way replicate.
- Budding happens when a parent cell develops a bud close to a bubble. When growing and developing, the bud remains connected to the parent cell. This get detached from the parent cell when the bud is completely grown, and becomes a new entity. It is common in hydra and yeast.
<u>Sexual Reproduction:</u>
- A reproductive process which comprises haploid female gamete fusion, i.e. egg cell and haploid male gamete i.e. sperm cell.
- That implies they only include half the number of chromosomes contained in other species cells. A form of cell division named meiosis creates gametes.
- These gametes are fused at fertilization which results in the production of a diploid zygote having the chromosome double of gametes.
Answer:
Arachidonic acids
Explanation:
Non-steroidal anti-inflammatory drugs (NSAIDs) are drugs used due to their analgesic, anti-inflammatory effects.
It inhibit cyclooxygenase (COX) enzyme that takes part in the biosynthesis of prostaglandins (PGs) and thromboxane (TX) and the production of eicosanoids.
Eicosanoids are made by the enzymatic or non-enzymatic oxidation of arachidonic acid or from other polyunsaturated fatty acids (PUFAs) that are close to arachidonic acid which are 20 carbon units in length.
They are important cell signaling molecules that inhibit inflammation, allergy, fever,regulate abortion of pregnancy and normal childbirth, regulating cell growth.
Answer:
Explanation:
TL;DR (Too Long; Didn't Read) The reactants for photosynthesis are light energy, water, carbon dioxide and chlorophyll, while the products are glucose (sugar), oxygen and water.
For the answer to the question above, <span>I think the answer is that Density-independent because it is an abiotic factor which is a natural phenomenon that occurs in the environment, it also affects the limiting factors of the environment.
</span><span>I hope this helps.
</span>
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
