1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nata [24]
3 years ago
5

What is the function of a smooth muscle tissue? ​

Biology
1 answer:
spin [16.1K]3 years ago
4 0

Answer:

Smooth muscle is found in the walls of hollow organs like your intestines and stomach. They work automatically without you being aware of them. Smooth muscles are involved in many 'housekeeping' functions of the body. The muscular walls of your intestines contract to push food through your body.

Explanation:

You might be interested in
How do systems in organisms prove that organisms are related?
AveGali [126]
They all have these traits: <span>Cellular organization, Reproduction, Metabolism, Homeostasis, Heredity, Response to stimuli, Growth and development, and <span>Adaptation through evolution.</span></span>
8 0
3 years ago
How many different genes do plant and animal cells contain?
Oksana_A [137]
The answer to this question would be...

B. Thousands

If you go to webpage <span>http://www.shapeoflife.org/2d-animal-cells-have-many-thousands-genes it will give you the same answer if you read through it.

Hope this helps a lot, leave a rating and like if it did!</span>
7 0
3 years ago
In a ____ circulatory system, fluid is pumped through specialized, enclosed vessels.
mart [117]

Answer: B. Closed

In a closed circulatory system is the one in which the blood is circulated to all the parts of the body of the organism through vessels of different length and width. In this system the blood is pumped from the heart through blood vessels where it is transported to different organs and cells of the body instead of filling up the body cavity.

7 0
4 years ago
Read 2 more answers
Please help! Match each organism with the correct trophic level it occupies in the food chain.
ale4655 [162]

Blueberry: 1st Trophic Level

Rabbit: 2nd Trophic Level

Snake: 3rd Trophic Level

Cat: 4th Trophic Level

Hope this helps :P

plz give me the brainliest if it does : )

7 0
3 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • Insulin is a(n) ________ that lowers blood sugar by allowing the body's cells to absorb glucose from the blood.
    14·1 answer
  • What could farmers do to prevent another potato famine?
    11·1 answer
  • What is the capacity of the cube in liters?
    14·2 answers
  • Number the steps in the correct order (1 through 5).
    5·2 answers
  • Why do some leaves decompose faster than others?​
    9·1 answer
  • Which level of biological classification do mammalia and Hominidae represent
    8·1 answer
  • What has changed in this room since you walked in?
    6·1 answer
  • In human traits, having dimples is dominant over not having dimples. If a mother heterozygous with dimples (Dd) and a father wit
    12·1 answer
  • ​Why do knuckles crack when you bend them
    15·1 answer
  • Mutations that result in much less of a protein or a protein with limited function are known as.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!