1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rina8888 [55]
2 years ago
10

It is the process in which the genetic code in mRNA is read, one codon at a time, to make a protein.

Biology
1 answer:
galben [10]2 years ago
4 0

Answer:

transcription

Explanation:

You might be interested in
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Lightweight fungal spores are surrounded by this
kramer

Answer:

Protective covering called Perdium

Explanation

Fungal spores are agents of asexual reproduction in Fungi.

The function is to protect the spores in fungi.It may be thick or thin depending upon the species. When the layers are two in number,

8 0
2 years ago
What is the study of genes? ethology genetics ecology classical conditioning
Drupady [299]
Genetics is the study of genes.
8 0
3 years ago
Read 2 more answers
Why do you get hungry?
suter [353]

Answer:You may feel hungry frequently if your diet lacks protein, fiber, or fat, all of which promote fullness and reduce appetite. Extreme hunger is also a sign of inadequate sleep and chronic stress. Additionally, certain medications and illnesses are known to cause frequent hunger.

Explanation:

"Hunger hormones" (ghrelin) in your blood and an empty stomach signal the brain when you're hungry. Nerves in the stomach send signals to the brain that you're full, but these signals can take up to 20 minutes to communicate -- and by that time, you may have already eaten too much.

8 0
2 years ago
What advantage does the membrane bound organelles give a eukaryotic cell over a prokaryotic cell?
aksik [14]
1) they allow for multiple reactions in the cell at once for example the mitochondria producing ATP for respiration and The Rough endoplasmic reticulum and ribosomes for protein synthesis 
3 0
2 years ago
Read 2 more answers
Other questions:
  • Cell at metaphase of mitosis contains 20 sister chromatids, how many chromosomes will be present in a g1 cell? if a cell at meta
    15·1 answer
  • Which are vegetative propagation techniques?
    5·2 answers
  • How many neutrons does element X have if its atomic number is 25 and its mass number is 92?
    11·2 answers
  • What are the Okazaki fragments?
    11·1 answer
  • You are playing basketball and the person you are guarding starts bleeding. you get blood on your leg. could you get hiv from th
    11·1 answer
  • What are the roles of fungi? Check all that apply.
    11·2 answers
  • The detection and encoding of stimulus energies by the nervous system is called a accommodation. b priming. c signal detection.
    9·1 answer
  • Question 9 of 10
    10·1 answer
  • How does the role of nucleic acids compare to the other biomolecules?
    9·1 answer
  • Most binary ionic compounds are also called metals.<br> A. True<br> B. False
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!