1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andreyy89
3 years ago
5

PLEASE HELP!!(Predict what would happen to the algae if all the fish were killed. BE SPECIFIC)~will mark brain

Biology
1 answer:
Readme [11.4K]3 years ago
6 0

Answer:

If all the fish died the algae population would gro due to not being eaten by the fish

Explanation:

You might be interested in
The process by which isogamous organisms exchange genetic information during fertilization is called _____.
natali 33 [55]
Conjugation
The process by which isogamous organisms exchange genetic information during fertilization is called conjugation.


In process of meiosis. The hypothalamus or the master gland in most animals, including humans send signals to the ovaries and testes of the reproductive system. In response to these signals, these ovaries and testes undergoes thesex cells division which is called meiosis<span>. </span>Spermatogenesis <span>in male gametes, is the process of sex cell division among sperm cells. On the other hand, </span>oogenesis<span> is for the female gametes. These cell divisions among respective gametes produces haploid cell which only contain one pair of chromosomes, in number -23.<span> </span></span>


3 0
3 years ago
The length of giraffes' necks enables them to reach leaves that most other herbivores can reach. If a giraffe is born with a ver
ZanzabumX [31]

Natural selection. The trait that is unfavorable to the baby giraffe's survival will cause the death of giraffes with that specific gene that is responsible for a short neck vs a long neck. Natural selection causes traits that help the survival of the species will be carried throughout generations while unfavorable traits will be lost.

5 0
3 years ago
Which step of scientific inquiry involves testing the hypothesis and collecting data?
egoroff_w [7]

The answer for this question would be letter A. Experimentation takes in by experimenting with your hypothesis, knowing what will happen and then gathering data from the outcome of the experiment. For your data, you create your analysis of what had happened then conclude.

4 0
3 years ago
Age-related loss of taste can be due to a(n) __________ number of sensory receptors
ivolga24 [154]
Age-related loss of taste can be due to a decreased number of sensory receptors. 

Good luck :)
7 0
4 years ago
Which substance is considered to be a proven ergogenic aid that increases athletic performance?
fenix001 [56]

Out of the following given choices;

<span>A.      </span>Salt tablets

<span>B.      </span>Bee pollen

<span>C.      </span>Carnitine

<span>D.      </span>Coenzyme Q10

<span>E.       </span>None of the above  

The answer is D. (none of the above). These elements are found  naturally in nature and in our bodies. Coenzyme Q-10 and carnitine are found naturally in our bodies while bee pollen and salt are found naturally in our environments. Therefore, it is implausible to consider them ergogenic substances






4 0
3 years ago
Read 2 more answers
Other questions:
  • When magma reaches the Earths surface its called?
    12·2 answers
  • Alan observed that a lot of soil from his garden swept off from after heavy rain. Which is this process called? A.groundwater re
    9·2 answers
  • The nurse is teaching a patient about the procedure for diaphragmatic breathing. which instructions should the nurse give to the
    11·1 answer
  • What is the sign finance of an AUG codon
    13·1 answer
  • Which type of water is the least dense?
    11·1 answer
  • The __________ guards the entry of food into the stomach.
    7·1 answer
  • How does light from stars indicate the universe is expanding?
    8·1 answer
  • What is the carrying capacity of the bacteria population graphed below?
    13·2 answers
  • 2 Points
    6·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!