1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Butoxors [25]
3 years ago
6

. Most of the matter in the universe: A. Exists within stars B. Is made when planets are formed C. Is unknown, called dark matte

r and energy D. Is blue-shifted
Biology
1 answer:
Genrish500 [490]3 years ago
3 0

Answer:

B

Explanation:

is made when planet are formed

You might be interested in
Identify the name of the proteins created by the immune system that attach to a pathogens and also cause agglutination in blood
Step2247 [10]

Answer:

c

Explanation:anitbodies are attached to the body of the pathogens then they r eliminated

8 0
3 years ago
ILL GIVE BRAINLIST PLS HELP​
TiliK225 [7]

Answer:

1.In biology, evolution is the change in the characteristics of a species over several generations and relies on the process of natural selection. The theory of evolution is based on the idea that all species? are related and gradually change over time.

2.Survival of the fittest is a simple way of describing how evolution (the process by which gradual genetic change occurs over time to a group of living things) works. It describes the mechanism of natural selection by explaining how the best-adapted individuals are better suited to their environment.

4 0
3 years ago
Plz help the question is the picture down below. And the subject is science I'm sorry guys I'm in a hurry
tatyana61 [14]

Answer:

clay water and silt

Explanation:

it may be right but not for sure

8 0
2 years ago
Read 2 more answers
Viruses without envelopes are more susceptible to xmchemical biocides than viruses with envelopes​
DedPeter [7]
What’s the question
3 0
2 years ago
In order for proteins synthesis to acquire both transcription and translation must occur which of the following statements descr
pashok25 [27]
Answer: In transcription, the genetic code of a DNA molecule is encoded. Translation is the process of converting DNA Code into a code that RNA can use.
3 0
2 years ago
Other questions:
  • Where is ATP synthase located in the mitochondrion?
    14·1 answer
  • Which description applies to the prominent transverse lines located on the anterior surface of the sacrum?
    7·1 answer
  • What is the path that sperm travels, starting from the seminiferous tubules and ending at the location of fertilization?
    15·1 answer
  • Which term best describes the relationship between the orcas and crabeater seals?
    11·2 answers
  • A new species of aquatic chordate is discovered that resembles an ancient form. It has the following characteristics: external a
    13·1 answer
  • 49. An organized attempt to influence the decisions of<br> lawmakers is called
    5·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • According to the food chain, label the following organisms appropriately. 1. secondary consumer cat 2. primary consumer grass 3.
    8·1 answer
  • The initial step in the formation of an aminoacyl-tRNA is Group of answer choices esterification of the tRNA activation of the t
    11·1 answer
  • Water is warmed by the sun and
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!