1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shepuryov [24]
3 years ago
12

Rain and snow remove _____ from the air. (Particulates)

Biology
1 answer:
ad-work [718]3 years ago
5 0

Answer:

participates is the answer

You might be interested in
What happen if your body don't got no cell
adell [148]
That isn't even possible. Your body is made of them. If you had none then you wouldn't be existing.
5 0
3 years ago
Read 2 more answers
1. __________________ are the basic building blocks of all matter, living and nonliving. They are made up of subatomic particles
disa [49]

Answer: Atoms are the basic building blocks of all matter, living and nonliving. They are made up of subatomic particles (neutrons, protons, and electrons)

Explanation:

Hope thats correct and helps! :)

7 0
3 years ago
How does enzyme concentration affect reaction rates?
Umnica [9.8K]
More enzymes more useful collisions
5 0
2 years ago
How many circulatory systems do dogs have?
andriy [413]

Answer:

I aint in college but Im pretty sure 3, the heart. Lungs. and blood vessels

Explanation:

5 0
3 years ago
The picture above shows barrier island. How did these barrier island MOST LIKELY form?
melamori03 [73]

Answer:

a

Explanation:

b

4 0
3 years ago
Other questions:
  • How do viruses spread and how do they affects your body? (Depending on which virus, you can pick any.)
    5·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • HELP FAST! Why was Alfred Wegener's theory of continental drift rejected?
    5·1 answer
  • What is cell surface to volume ratio and why is it important in cell functioning? Can it explain why cells are so small?
    7·1 answer
  • Which of the following best defines “model?”
    11·2 answers
  • If you palpate the bony projection on the lateral side of your wrist, just proximal to the thumb, what part of the radius are yo
    11·1 answer
  • In activating cytokine receptors, a: Please choose the correct answer from the following choices, and then select the submit ans
    9·1 answer
  • Which of the following is an interaction in which both organisms benefit? Parasitism Mutualism Competition Commensalism.
    6·1 answer
  • Calculate the orbital period of a satellite that orbits two earth radii above the surface of earth​
    5·1 answer
  • ____________ is translated by the ribosomes and contains the code that specifies the sequence of amino acids in a polypeptide ch
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!