1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksi-84 [34.3K]
3 years ago
12

Determine the components of carbohydrates and proteins.

Biology
1 answer:
patriot [66]3 years ago
3 0

Answer:

Explanation:

the components of carbohydrates are carbon , hydrogen and oxygen whereas the components of proteins are carbon, nitrogen , oxygen and nitrogen

You might be interested in
What are two things that all non vascular plants share?
Zepler [3.9K]
<span>They do not have a phloem or xylem.</span>
4 0
3 years ago
An organism is unicellular, contains chlorophyll, and has a flagellum. to which kingdom does this organism belong?
denis23 [38]
This organism belongs to the Plantae kingdom
8 0
3 years ago
Daughter cells in meiosis will receive either ALL chromosomes from the father or ALL from the mother
amid [387]
False , they receive half
4 0
2 years ago
Read 2 more answers
In this lab, you will simulate birds with three different beaks. After watching the birds feed, you will remove fruit to simulat
CaHeK987 [17]

Answer: what is effect of food type on the different bird beaks

Explanation:

Birds have specialized beaks for whatever food they eat! Birds that eat seeds typically have a broad, come shaped bill used for crushing seeds. I hope this helps!

7 0
3 years ago
Read 2 more answers
Explain how one's personality relates to his choice of a career. Explain how one's personality relates to his choice of a career
Jlenok [28]

...I'm not exactly sure if I'm answering this correctly, but I believe if we're talking about Career Development this may be about the Parsons' theory? The Parsons' theory assumes that a personality could be matched to an occupation, depending on those personality traits.

If someone has a career/job that feeds on specific things that person is good at, then I think they'd stick with that job. Especially if it's a job they love, and or are very happy with it! I would say certain personalities work better with certain careers.


I.. hope this helps? Lol

6 0
3 years ago
Read 2 more answers
Other questions:
  • The patient is a 68-year-old man who has had shortness of breath (SOB) for the past 2 to 3 days. Compose two (2) complete nursin
    15·1 answer
  • He transfer of pollen from the male reproductive structure to the female reproductive structure is called
    10·1 answer
  • Vultures which are classified as scavengers are an important part of an ecosystem because they
    6·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What is one way in which sending information by digital signals is better than sending it by analog signals
    15·1 answer
  • What tissue contains large amounts of fluid and transports nutrients wastes and gases?
    7·1 answer
  • Definiton of crossing over
    13·2 answers
  • What the answer pls science
    7·1 answer
  • EMERGENCY HELP FAST!!<br><br> Fats and oils are esters. They contain a ____ group.
    5·1 answer
  • HELP ! 50 POINTS !!
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!