1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MakcuM [25]
3 years ago
13

At what point is a star born?

Biology
2 answers:
avanturin [10]3 years ago
8 0

Answer:

A star is born when atoms of light elements are squeezed under enough pressure for their nuclei to undergo fusion. All stars are the result of a balance of forces: the force of gravity compresses atoms in interstellar gas until the fusion reactions begin

Explanation:

Wewaii [24]3 years ago
7 0

Answer:

when it's born a star is born when it's born

You might be interested in
How do the respiratory and circulatory depend on each other for gas exchange?
Juli2301 [7.4K]

Answer:

Explanation:

Haemoglobin in the red blood cells which is one of the components of the circulatory medium, the blood, has a great affinity for oxygen hence transports it around the body during circulation. It is the circulatory system that carries both oxygenated and deoxygenated blood around the body, between the lungs and the heart. The circulatory system takes blood with carbon dioxide to the lungs where oxygen that entered into the body through the nostrils will be exchanged with carbon dioxide in the alveoli. Consequently carbon dioxide will go out of the body through the nostrils via the trachea and haemoglobin in the red blood cells in the blood( blood capillaries) will

carry oxygen which is transported around the body.

5 0
3 years ago
Can mold make u sick ​
mariarad [96]

Answer:

It depends on the mold.

Explanation:

Blue cheese, as well as all cheeses, are molds. These are safe to eat. However, eating moldy bread will make you sick, and while it is usually not fatal, it is best to consult a doctor. If you inhale black mold spores, it will grow in your lungs and eventually kill you.

6 0
3 years ago
Read 2 more answers
50 POINTS GIVING BRAINLIEST ALSO!!!!!
nikklg [1K]
"two ages o'er his native realm he reign'd"

0 0
3 years ago
Read 2 more answers
What happens when human body temperature rises during exercise?
In-s [12.5K]
There heart began to beat faster and their body produce more sweat and there blood is following faet
7 0
3 years ago
Cu+AgNO3=Ag+Cu(NO3)2 how to done it
maria [59]
It is Chemistry.
Cu+AgNO3=Ag+Cu(NO3)2
==>
Cu+2AgNO3=2Ag+Cu(NO3)2
7 0
3 years ago
Other questions:
  • Summary about the water cycle the carbon cycle and the nitrogen cycle and phosphorus cycle
    6·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Darwin observed fossils of huge animals such as glyptodon a giant armadillo why were there fossils of interest to him
    11·1 answer
  • Which set of properties distinguishes potential energy from kinetic energy?
    10·2 answers
  • Why does ice float when it is placed in
    11·1 answer
  • What are 4 reasons coral reefs are disappearing?
    10·1 answer
  • Viruses are considered non-living organisms because:
    15·1 answer
  • Which of the following is a domain consisting of protists, fungi, plants, and animals?
    14·2 answers
  • Which statement describes a connection between photosynthesis and cellular respiration?
    7·1 answer
  • What is the life cycle of a protozoa in stages ?<br> Please help me thank you
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!