1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
viktelen [127]
2 years ago
12

The system that controls and coordinates the body through hormones is the ________.

Biology
1 answer:
butalik [34]2 years ago
7 0

The system that controls and coordinates the body through hormones is the <span>endocrine system.</span>

<span>Endocrine system produces hormones and then these hormones transmit the messages to various cells within the body. Hormones have great importance in our body system and even our body is functioning due to hormones.  If hormones are disturbed it can lead to many diseases.</span>

You might be interested in
Humans have 46 chromosomes and monkeys have 48 chromosomrs in their cells. Match the cells with the number of chromosomes they c
Mamont248 [21]
Sperm cell (gamete) in humans = 23
Zygote in monkeys = 48
Zygote in humans = 46
Egg cell (gamete) in monkeys = 24
5 0
3 years ago
What is the entire object shown in the image?​
Mademuasel [1]
That is an (a)prokaryote.
4 0
2 years ago
Read 2 more answers
As a scientist, you seek to prove that DNA is the hereditary macromolecule by replicating the Hershey-Chase experiment. You cult
weeeeeb [17]

Answer:

The correct answer is option e. "None of the above".

Explanation:

The Hershey-Chase experiment helped to prove that DNA was the genetic material, by specifically labeling the DNA material of a bacteriophage with phosphorus-32. In this experiment the lambda phage is labeled with heavy and light Cl. CI-36, the one that is heavy and radioactive, corresponds to Chlorine-36. Chlorine is not an element found in DNA such as phosphorus, therefore lambda DNA will not be labeled and no radioactivity will be detected.

6 0
3 years ago
How does hemoglobin function as a pH buffer?a.Hemoglobin binds hydrogen ions when carbon dioxide exits the red blood cell. b.Hem
Gre4nikov [31]

Answer: Option C.

Haemoglobin binds Hydrogen ion after carbondioxide enters red blood cells.

Explanation:

Haemoglobin is the protein in the red blood cells that help to transport oxygen in the blood. It is an iron compound. Haemoglobin acct as buffer by binding to acid or hydrogen ion in the blood when carbondioxide enters the blood, to remove the acid in the blood before it changes the blood pH.

6 0
2 years ago
Which of the following cell types is haploid
wolverine [178]
Haploid cells are sex cells or gametes.
7 0
2 years ago
Other questions:
  • During the entire month of June, temperatures increase in the Northern Hemisphere and decrease in the Southern Hemisphere. What
    15·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • In a lysogenic infection the viral DNA that is embedded in a host cells DNA is called
    8·2 answers
  • Henri Becquerel and the Curies worked with uranium, radium, and polonium, all of which give off _____. sunlight radiation elemen
    5·1 answer
  • Which is not a major similarity or difference between freshwater and marine ecosystems?
    15·2 answers
  • a mother who is a carrier of sickle cell produces a child with a father who is also has sickle cell. Whats the genotype of the m
    9·1 answer
  • A new organism is discovered at the bottom of the ocean. A scientist is determining the composition of elements found in the tis
    15·1 answer
  • WILL GIVE BRAINLIEST!!! FORENSIC SCIENCE
    13·1 answer
  • Indicate whether each of the following descriptions is true of microtubules (MT), microfilaments (MF), intermediate filaments (I
    12·1 answer
  • Which step in the process of cellular respiration produces the most ATP?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!