1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexxx [7]
3 years ago
11

- Why was the shift to farming a big deal?

Biology
1 answer:
max2010maxim [7]3 years ago
5 0

Answer:

Bowles and Choi suggest that farming arose among people who had already settled in an area rich with hunting and gathering resources, where they began to establish private property rights. When wild plants or animals became less plentiful, they argue, people chose to begin farming instead of moving on.

Explanation:

You might be interested in
If someone told you they had a career in either ecology, paleontology, or botany, what area of science is this? A) physics B) ch
Harrizon [31]
I believe the answer would be d, biology
8 0
4 years ago
Read 2 more answers
If you have one side of a DNA “ladder” with the base-pairs ACTGACTGACTG, what would the base-pairs on the other side of the “lad
Marina CMI [18]
I remember learning about this.. I think it’d be “TGACTGACTGAC”
7 0
3 years ago
What is a non examples of a ribosome
wariber [46]
A nonexample is the nucleus and the contents of the nucleus, like a membrane 

hope this helps
7 0
3 years ago
Compare and contrast members of order squamata with members of order sphenodonta
lord [1]

Answer:

Sphenodontia

  • least specialized of all living reptiles
  • arose in the Mesozoic era
  • include tuataras;
  • several unique features of the skull and jaws clearly define them and distinguish the group from the squamates

Squamata:

  • Most specialized reptiles.
  • arose in the late Permian
  • include lizards and snakes
  • largest extant clade of reptiles
6 0
3 years ago
What do you call a pig in a pawn shop?
Art [367]
ChaCha is your answer
7 0
3 years ago
Other questions:
  • The hormone responsible for stimulating uterine contractions is:
    6·1 answer
  • What are the fingerlike projections of the small intestine that increase the absorptive surface area?
    9·1 answer
  • The ______ cavity contains the lungs, heart, esophagus, and trachea
    12·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • 13 Which of the following chemical compounds
    9·1 answer
  • I Will Give BRIANIEST
    5·2 answers
  • Fill in the definition of a fossil. A fossil is the _____ physical _____ of _____ life.
    7·1 answer
  • If the percent of guanine in a DNA strand is 14%. What is the percent of thymine in<br> that DNA?
    6·1 answer
  • How can fish farming still deplete ecosystems?
    13·1 answer
  • A plant is 15 inches tall and grows at a rate of 0. 5 inches per week. Write a function h that models the height of the plant, i
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!