1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mila [183]
3 years ago
14

What does Acid release when dissolved in water

Biology
1 answer:
slega [8]3 years ago
4 0

Answer:

B. Hydroxide ion

Explanation:

An acid is an iconic compound that produces positive hydrogen ions/ hydroxide ion when dissolved in water.

You might be interested in
rue or false: DNA replication in eukaryotes occurs unidirectionally from multiple origins of replication.
IrinaVladis [17]

Answer:

False

Explanation:

In eukaryotes, replication begins from multiple origins of replication and the replication forks move bidirectionally to replicate the DNA.

6 0
2 years ago
The excessive concentrations of circulating parathyroid hormone appeared to be caused by a tumor of the parathyroid gland or ___
Reika [66]

Answer:

parathyroidoma

Explanation:

The condition where the parathyroid hormone is produces excessively is termed as Hyperparathyroidism. This condition arises when the balance between the calcium and phosphorus gets disturbed. The calcium and phosphorus balance is affected in following two cases –  

a) When the parathyroid gland is not working properly due to its own problem usually termed as hyperparathyroidism or more specifically primary hyperparathyroidism

b) When the parathyroid gland is not working properly due to any other disease in the body affecting the functioning of parathyroid. It is termed as secondary hyperparathyroidism  

4 0
3 years ago
A new older female client at a long term care facility has a diagnosis of neurofibromatosis type 1. As part of the intake assess
mojhsa [17]

Answer:

Explanation:

Her diagnosis puts her at higher risk of developing a malignant neoplasm

8 0
3 years ago
DNA<br>"Deoxyribonucleic<br>Acid"​
Zarrin [17]

Answer:

Details about DNA are given in the explanation section. Hope it will be helpful for you.

Explanation:

DNA, or deoxyribonucleic acid, is the hereditary element in humans and almost all other organisms. Nearly every cell in a person’s body has the same type of DNA. Most DNA is found in the cell nucleus (nuclear DNA), but a small quantity of DNA can also be found in the mitochondria (mitochondrial DNA or mtDNA).

The information in DNA is stored as a code made up of four chemical bases: adenine (A), guanine (G), cytosine (C), and thymine (T). Human DNA consists of about 3 billion bases, and more than 99 percent of those bases are the same type in all people.

DNA bases pair up with each other, A with T and C with G, to form units that are called base pairs. Each base is also attached to a sugar molecule and a phosphate molecule.  A base, sugar, and phosphate are called a nucleotide. Nucleotides are arranged in two long strands that form a spiral called a double helix.

A valuable feature of DNA is that it can replicate, or make copies of itself. Each strand of DNA in the double helix can serve as a pattern for duplicating the sequence of bases.

7 0
3 years ago
What are the bacterial transformation steps
schepotkina [342]

Answer:

Explanation:

Preparation of competent cells  -

Transformation

recovery

plating

7 0
2 years ago
Other questions:
  • What role does cellular respiration play in the water cycle
    13·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What do you do when you want to fight someone but don't want to take the consiquence
    15·1 answer
  • How is RNA used in therapies and diagnostics?
    9·1 answer
  • A collection of stars, dust, and gas bound together by gravity is... a. universe b. solar system c. planet d. galaxy explain why
    6·1 answer
  • Please help me, anything will help. I think 5 is B.
    7·2 answers
  • The smallest structure of a muscle are called myofilaments. Which of the terms below represents the specific myofilaments? Selec
    15·1 answer
  • 1. Choose the graph that correctly represents the relationship of nucleotides in DNA and support
    8·1 answer
  • Find the mass of the cone using the triple beam balance.
    13·1 answer
  • Which process connects glycolysis and the citric acid cycle?What role does cellular respiration play in the carbon cycle?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!