1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
poizon [28]
3 years ago
9

if an F2 fly with normal wings is crossed with another F2 fly with normal wings, then what will the trait(s) of the offspring be

?
Biology
1 answer:
zepelin [54]3 years ago
7 0

Answer:

legs air wind balance

Explanation:

all u gotta do it use ur brain

You might be interested in
In addition to ATP, what are the end products of glycolysis?
vovikov84 [41]

Answer: C) NADH and pyruvate

Explanation: Glycolisis is enzymatic pathway where glucose and other sugars are oxidized to produce direct energy as ATP, energetic intermediaries as NADH and pyruvate. Later, pyruvate will be converted in acetyl coA to enter to Kreb's cycle and NADH and others produced, will be used in the electron transport chain in mithocondria, to produce more ATP.

6 0
4 years ago
List three types of evidence that plants existed on Antarctica.
Advocard [28]

Pollen , coal and stems  are evidences that plants existed in Antarctica.

Explanation:

  • Pollens being highly resistant to temperature changes due to the presence of sporopollenin must have remained preserved in ice covered continent of Antarctica.
  • Pollens are reproductive units of Plant that suggest existence of plants in the Ice covered land.
  • Coal is formed as the fossilization of plants under anaeorobic conditions and high pressure. thus, this also suggest the existence of plants.
  • Stems are plant parts thus clearly is an evidence that plants existed there.
5 0
3 years ago
PLEAS HELP
vlada-n [284]
A b or d that’s the answer i think idek
8 0
3 years ago
All of my frnds. pls talk
grigory [225]

Answer:

hey

Explanation:

3 0
3 years ago
Read 2 more answers
How do all multicellular organisms begin? A. as complex organisms B. as a single cell C. by expanding the size of their cells D.
exis [7]
<span>B is the correct answer. Multicellular organisms, as with almost all organisms, begin life as a single cell. The increase in the number of cells can be as a result of cell division or cells combining together. </span>
4 0
3 years ago
Other questions:
  • Exocytosis is the process by which vesicles in the cytoplasm fuse with the cell membrane, releasing their contents into the cell
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Muscle fibers that have many mitochondria and contain myoglobin are (A) fast-twitch muscles. (B) skeletal muscles. (C) smooth mu
    8·1 answer
  • 12. Solar energy enters food chains through the life processes of
    14·1 answer
  • A.
    9·1 answer
  • When someone<br> blows on<br> DNA<br> plants<br> Genetic<br> Factors
    7·2 answers
  • Pls Help me!!! Thank you!!
    5·1 answer
  • What does mRNA do?
    12·1 answer
  • Can someone give me the answer I need help
    11·1 answer
  • DNA is measured in:<br><br> please help
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!