1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
soldier1979 [14.2K]
3 years ago
6

Explain the process of how viruses hijack cells. Include the following words: membrane; protein

Biology
1 answer:
Kryger [21]3 years ago
3 0

Answer:

The viral replication process begins when a virus infects its host by attaching to the host cell and penetrating the cell wall or membrane. Then the viral genome hijacks the host cell's machinery, forcing it to replicate the viral genome and produce viral proteins to make new capsids. In the past, viruses were considered nonliving infectious particles, little more than genetic material wrapped in a protein capsid. Today, virologists are beginning to think of viruses as living organisms that can be classified phylogenetically into defined species, much like any other living organism. The primary reasons for this shift in attitude can be partially attributed to the discovery of giant viruses, having large genomes and complex regulatory systems. Aside from that, it has become obvious that viruses lead complex lives; they evolve, speciate, and participate in the evolution of all classes of living organisms. In this chapter, we will discuss the early attempts to classify viruses, and review the biologic properties of the classes of virus that contain human pathogens.

Explanation:

Brainliest please?

You might be interested in
Monopar Therapeutics at McKesson implemented an open-innovation model, which greatly benefitted the company. In the light of thi
beks73 [17]

Monopar Therapeutics is an intrapreneur. It is a classification in investment.

<h3>What is an intrapreneur?</h3>

An intrapreneur refers to a person/association aimed at promoting original products and/or services for their development.

An intrapreneur has positive behaviors while working hard within a company and/or organization.

An intrapreneur is always searching for new ventures within the company in which this manager works.

Learn more about intrapreneurs here:

brainly.com/question/396058

4 0
2 years ago
Which organelles do scientists believe originated by symbiotic relationships between primitive eukaryotes and certain prokaryote
AnnyKZ [126]
The organelles  that scientists  believed  that  it originated  by  symbiotic  relationships  between   primitive  eukaryotes  and  certain  prokaryotes   is  known as chloroplast. Chloroplast  contain   chlorophyll  which  capture  energy  from sunlight  that  is  used   in  photosynthesis .This  energy  is  converted  to  ATP  and NADPH
7 0
4 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
1. What type of succession takes place that increases the biological diversity of an ecosystem? For example, if we started with
professor190 [17]

There are two types of succession that lead to the increasment of the ecosystem:

1. Primary succession is the change in the structure of an ecosystem represented with the increase of the ecological community on an area that has not been previously occupied by an ecological community such as area after the lava flow or glacial lake. The first organisms of primary succession are pioneer plants usually, lichens and mosses.

2. Secondary succession includes the step of removal of pre-existing community and after that, colonization of the new one.  


6 0
3 years ago
I need help please and thank you!
kotegsom [21]

Answer:

those cause by bacteria

Explanation:

Antibiotics fight bacterial infections either by killing bacteria or slowing and suspending its growth. They do this by: attacking the wall or coating surrounding bacteria. interfering with bacteria reproduction.

5 0
3 years ago
Read 2 more answers
Other questions:
  • A method for assessing your body size by taking your height and weight into account is the
    9·2 answers
  • Explain how carbon is transferred within and between organisms and the environment.
    6·2 answers
  • How have atmospheric carbon levels changed?
    15·1 answer
  • What Is true of all eukaryotes?
    5·2 answers
  • A store sells five brands of potato chips, some more popular than others. Which of the following would be best show the populari
    13·2 answers
  • Why are bacteria well suited to produce useful substances as a result of biotechnology?
    11·2 answers
  • As part of a long-term elephant study, biologists counted individuals in a population of elephants each spring. In one year, the
    8·1 answer
  • 1ª) O que caracteriza a vida?​
    10·1 answer
  • Would a cell that did not undergo cytokinesis be able to function properly? Explain.
    15·1 answer
  • HELP ASAP PLEASE HELP FAST
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!