Answer:
Chromosome 21 in figure D is the result of a process known as non-disjunction
Explanation:
Meiosis is the process of cell division that serves to obtain gametes, cells with exactly half the chromosome load of the species. This process involves the equal distribution of chromosomes in each daughter cell.
Non-disjunction is an alteration in the separation of the sister chromatids during meiosis, resulting in a gamete with non-separated sister chromatids, which when joined to a normal gamete can produce an organism with an extra chromosome.
In the karyotype shown in the photo, the non-disjunction in chromosome 21 produces a trisomy, a type of aneuploidy seen in Down syndrome.
Learn more:
Trisomy brainly.com/question/484286
I think the correct answer is A
The nucleic acids that moves the code for protein synthesis from the nucleus to the ribosomes is : D. mRNA
This code is most commonly known as the Transcript, which is very important in DNA forming process
Hope this helps
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer is B
Increase the odds by creating relationships among organisms.
