Answer:
They are divided on the basis of flowering and non-flowering plants I.e. Angiosperms and Gymnosperms
Explanation:
During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Answer:
so they adapt to their environment
Explanation:
Acceleration of a body is defined as rate of chance in velocity with respect to time and its S.I. Units are / or
Magnitude of average acceleration of a body = (final speed - initial speed)/time interval =
where, final speed =v= 11 m/s; initial speed = u = 6 m/s; and time interval = t = 3 s
Hence acceleration = = =