1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paul [167]
2 years ago
15

In your own words define the terms: trait, gene, and alleles.

Biology
1 answer:
Oksana_A [137]2 years ago
5 0

Answer:

trait: is a characteristic of the organism they include hair color or leaf color, size and even shape. a trait with a genetic contribution is called a genotype and they way or the outward expression of that genotype is called a phenotype.

gene: is a segment of that DNA some of the genes can give instructions in order to produce proteins

alleles: it is a version of a gene and they are located on the same part of the chromosome and we normally inherit 2 alleles for each gene

Explanation:

You might be interested in
Is the phenotype that corresponds to the HbS allele harmful, beneficial, or both?
horrorfan [7]

Phenotype is referred to as the expressed trait that is caused by a certain combination of alleles.

<h3>What is phenotype?</h3>

Phenotype is referred to as the expressed trait that is caused by a certain combination of alleles. We will recall that the HbS allele is responsioble for the anemia that results from sickle shaped red blood cells.

This phenotype is both harmfull and benefical in the sense that it leads to the agglutination of the red blood cells in individuals that have this phenotype and eventual crisis. Also, it is beneficaila in that nthose who possess this phenotype do not suffer from malaria in the tropics.

Learn more about HbS allele: brainly.com/question/12347919

3 0
2 years ago
Some complex multicellular organisms are organized at four levels to increase efficiency. Which list names the correct order of
djverab [1.8K]
It would be d because a cell is least complex and organ system is most complex
6 0
3 years ago
An energy resource that can be replaced by nature in a relatively short time is known as a(n): a. replaceable energy resource b.
lara31 [8.8K]
An energy resource that can be replaced by nature in a relatively short time is known as a "<span>inexhaustible energy resource" but these are very rare in nature. </span>
8 0
2 years ago
Read 2 more answers
Cual hormona de la pituitaría estimula la producción de testosterona?
Lostsunrise [7]

Explanation:

Cuando los niveles de testosterona están bajos, la hormona liberadora de gonadotrofina (GnRH) es liberada por el hipotálamo que a su vez estimula la glándula pituitaria para liberar LH. Esta última hormona estimula los testículos para sintetizar la testosterona.

3 0
2 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
Other questions:
  • What type of rock is formed from cooling magma? Select all that apply.
    13·1 answer
  • Help !
    9·1 answer
  • Which best describes the big bang theory? A. The universe is 4.6 billion years old. B. The universe is shrinking. C. Our univers
    15·2 answers
  • 2.
    14·1 answer
  • How dose light intensity affect the rate of photosynthesis
    10·2 answers
  • Intervention by the federal government is necessary when local environmental policies and actions
    6·2 answers
  • O que é soros nas plantas
    8·2 answers
  • Folds and faults, extension stress, compression stress, and shear stress are all the result of what?
    12·2 answers
  • There are many stars and other objects in the universe. True False
    6·2 answers
  • How are the electrons in the PS II system replaced?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!