1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tamiku [17]
3 years ago
10

What types of cases are best investigated with survey rather than an experiment

Biology
2 answers:
Alik [6]3 years ago
7 0
What are people's favorite colors? How does the color purple make people feel? Something like that
VladimirAG [237]3 years ago
5 0
Hi!

We experiment by following scientific principles, and the scientific method. It's through this method that we reach scientific, credible answers which are factual.

In some cases, an experimental question <em>cannot </em>be answered via experimentation. This happens when the question at hand is something that cannot be explained or proved scientifically.

These questions will be <em>subjective </em>and will vary depending on the person. Such questions will ask things like 'What is everyone's favourite animal?'

For this question, we can't exactly answer it scientifically. Therefore, we will not carry out scientific experimentation onto it.

This is when we will use a <em>survey, </em>instead of an <em>experiment. </em>

Hopefully, this helps! =)
You might be interested in
An interdependent community of plants and animals is called:
max2010maxim [7]

Answer: An ecosystem

Explanation:

8 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
What planet is referred to as a gas giant
Sophie [7]
There are actually two planets referred to as gas giants which are Jupiter and Saturn. These two planets are made of mostly helium and hydrogen which makes them gas giants, while Uranus and Neptune have more ice and rock substances, so they are not considered gas giants.
3 0
3 years ago
How much of the weight of a cell is water
Liula [17]

Answer:

I don't know if this is what you are asking, but water weighs 70% of a cell.

8 0
3 years ago
Read 2 more answers
What type of smell is most easily detected?
Vesna [10]
Urine or trash or air
3 0
3 years ago
Other questions:
  • Phagocytosis is to eating as pinocytosis is to
    6·1 answer
  • After which event could you say with most certainty that evolution has occurred?
    5·1 answer
  • I need help I am stuck on this problem
    10·1 answer
  • What are the three most commonly used instruments for the determination of free-living physical activity and energy expenditure?
    10·1 answer
  • What are some ways water is used inside and around the home? Check all that apply. boiling pasta for dinner watering the front l
    9·2 answers
  • Where does the heating process begin in a hot water heater system?
    9·1 answer
  • What affects do islands have on animal size
    9·1 answer
  • What are the 4 differences between eukaryotic/ prokaryotic
    15·2 answers
  • How does increased pressure result in the formation of a mineral?
    14·2 answers
  • My sister lives with my parents into negative <br><br>​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!