1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leona [35]
2 years ago
8

Why do you think the winter layers are darker than the summer layers in the ice core?

Biology
1 answer:
Ulleksa [173]2 years ago
3 0

Answer:

Why do you think the winter layers are darker than the summer layers in the ice core? The winter layers are darker than the summer layers because little snow falls in the winter. ... The summer layers are lighter because the snow that falls in the summer is cleaner; there are fewer particles caught in the snowfalls.

Explanation:

You can put it in your own words if you want. Hope this helps!

You might be interested in
What would happen is rabbits from a warm, southern climate were moved to a cold, northern climate?
SVETLANKA909090 [29]

Answer:

They would freeze and it would be hard to find food because they are not accustomed to the different climate. They would also be easy prey because of the environment change they are not equipped for.

7 0
2 years ago
Read 2 more answers
A client who was trapped inside a car for hours after a head-on collision is rushed to the emergency department with multiple in
meriva
This finding indicates the damage of the mid-brain
This is evident due to the Decerebrate posturing, which is characterized by abnormal extension in response to painful stimuli, that indicates damage of the midbrain. On the other hand, damage to the diencephalon or cortex, abnormal flexion, occurs when a painful stimulus is applied. While medulla damage results in flaccidity.
7 0
3 years ago
2 Describe List three devices that produce
agasfer [191]

Answer:

list of three devices are 1st phone 2nd doorbell 3rd alarm clock

Explanation:

if these devices will not produce sound then we can not do our work properly these are very useful for everyday life

5 0
2 years ago
The advantage of using a scale model?
skad [1K]

Answer:

H. It represents the actual size but it is big enough for the eye to see making it extrememly accurate

Explanation:

6 0
3 years ago
Read 2 more answers
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Other questions:
  • Which land formation is the result of a convergent boundary? A. central United States B. South American volcanoes C. Hawaiian vo
    15·2 answers
  • Which part of the neuron communicates an electrical signal to target tissue?
    11·1 answer
  • What color is the offspring of a purple and green flower?
    7·1 answer
  • ___ energy is how much energy is required to start a reaction.
    8·1 answer
  • if a father has type a blood and a mother has type b blood what blood type(s) could their children possibly have
    7·1 answer
  • Which statement is true of the genetic material in viruses
    14·2 answers
  • According to the image below, which season is about to begin in the southern hemisphere?
    15·2 answers
  • Which statements accurately describe the structure of the cell membrane? Check all that apply. The cell membrane is a single lay
    6·2 answers
  • Why isn’t breathing considered a life function?
    12·1 answer
  • Select all that apply. Which of the following are characteristics of eukaryotes? membrane-bound organelles cell(s) larger than p
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!