1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kati45 [8]
3 years ago
11

What are the two uses of legume forage crops in Ethiopa?​

Biology
1 answer:
Gnom [1K]3 years ago
6 0

Answer:

1.supply of better

quqlity food for animals

२.recovering and improving soil nutrients

Explanation:

by providing nitrogen fixing bacteria

You might be interested in
Select the correct sequence concerning glucose catabolism. glycolysis - pyruvate - acetyl - coa - electron transport chain - kre
Natali [406]
The correct sequence is; Glycolysis-pyruvate-acetyl CoA-krebs cycle-electron transport chain. 
Glycolysis is a sequence of reactions for the breakdown of glucose to two molecules of pyruvic acid under aerobic conditions, Krebs cycle is a series of chemical reactions used by all aerobic organisms to release stored energy through the oxidation of acetyl-CoA derived from carbohydrates, fats, and proteins into carbon dioxide and chemical energy in the energy carriers, while electron transport chain involves a series of complexes that transfer electrons from electron donors to electron acceptors via redox reactions and couples this transfer with the transfer of protons across a membrane. 
5 0
3 years ago
Which of the following is the equation for acceleration?
belka [17]

Answer:b.

Explanation:

3 0
3 years ago
Read 2 more answers
A forensic scientist is trying to find out the number of adenine in the DNA sample that he obtained from a crime scene.
Anuta_ua [19.1K]

The right answer is The number of adenine will be equal to the number of thymine.

Chargaff's rules indicate that the DNA of any cell or organism must have a ratio of 1 to 1 between purine bases and pyrimidine bases and, more specifically, that the amount of guanine is equal to the amount cytosine, and that the amount of adenine is equal to the amount of thymine. This trend is found in both strands of DNA.

7 0
2 years ago
Read 2 more answers
Which of the following best describes the term predation?
worty [1.4K]

one species using another as a food source, typically killing it

7 0
3 years ago
Read 2 more answers
Recycling livestock wastes, managing rainwater runoff, and rotating crops are examples of _____ agriculture practices
Effectus [21]
Are examples of organic
3 0
3 years ago
Read 2 more answers
Other questions:
  • Chloroplasts are unable to survive without the energy they receive from cell respiration. What conclusion can be drawn from this
    13·2 answers
  • In Unicorns diamond eyes are dominant over emerald eyes. Two unicorns with diamond eyes have 4 babies. 1 of their babies has eme
    13·2 answers
  • The model below represents a phase of meiosis. What stage of meiosis does the picture below represent?
    10·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • The epithelium of the esophagus is composed of which type of epithelial tissue?
    15·1 answer
  • What evidence must be considered when determining whether or not a trait is an adaptation
    10·1 answer
  • Weathering most often takes place
    8·2 answers
  • What ignited the Cambrian explosion of life?
    5·1 answer
  • Some organisms can become _____ to survive an unsuitable environment.
    8·1 answer
  • If all of the trees in the area were cut down, the energy supply of which population would be most directly affected
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!