1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kolbaska11 [484]
3 years ago
13

A team of scientists mapped a forest where orangutans live in a national park

Biology
2 answers:
nalin [4]3 years ago
8 0

Answer: A

Explanation:

A geographic information system (GIS) is a computer system for capturing, storing, checking, and displaying data related to positions on Earth’s surface.

vova2212 [387]3 years ago
7 0

Answer:

Option (A)

Explanation:

GIS is used as a technique to assemble, supervise and scrutinize the data and utilizing them in creating a 3D model of it. These help in determining the geographical attributes of an area. Satellites are being used to obtain these data.<u> This system is used to construct large and small scale maps. It shows how changes take place in a particular area with a gradual increase in time. </u>

Thus, the correct answer is option (A).

You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
The idea that all life is based on cells and that cells come only from other cells is known as the cell theory
balu736 [363]

true this idea is correct

3 0
3 years ago
While __________ bacteria retain carbol fuchsin after acid-alcohol treatment, __________ bacteria are decolorized by acid-alcoho
Lisa [10]
<span>While Acid fast bacteria retain carbol fuchsin after acid-alcohol treatment, non- Acid fast bacteria are decolorized by acid-alcohol.
Bacteria of genus mycobacterium are best stained using acid-fast method. A mixture of Phenol and fuchsin is carbol fuchsin. In acid-slcohol, acid is hydrochloric acid.</span>
6 0
3 years ago
If a wave travels 10 meters in 2 seconds what is the speed of the wave.
Eddi Din [679]
10000000 km per second which is really fast lol
5 0
3 years ago
1.Which wave has a disturbance that is perpendicular to the wave motion?
Alexxandr [17]
The answer is transverse wave
3 0
3 years ago
Read 2 more answers
Other questions:
  • Dr. Semmelweis, a physician from Austria, wanted to locate the cause of childbed
    13·2 answers
  • Frogs – a species of frog's population grows 24% every year. suppose 100 frogs are released into a pond.
    13·1 answer
  • What is the name of this organelle?
    13·2 answers
  • Some students are performing a hydrobiology project on a creek. They obtained the GPP value as 7 mg/l and the R value as 3 mg/l.
    9·2 answers
  • Please help!
    10·1 answer
  • How many chromosomes does a coyote have
    13·2 answers
  • Over the decades local and global ice ages have lowered sea levels. As a result, there is often a decline in marine diversity du
    7·2 answers
  • Please answer asap!
    7·2 answers
  • What did Mendel's cross-pollination of pea plants prove?
    5·1 answer
  • A client has been started on long-term therapy with rifampin. the nurse should provide which information to the client about the
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!