A i am pretty sure it is a
Answer:
Pesticides vary in their effects on bees. Contact pesticides are usually sprayed on plants and can kill bees when they crawl over sprayed surfaces of plants or other areas around it. ... When a bee comes in contact with pesticides while foraging, the bee may die immediately without returning to the hive.
Answer:
B. Adenine and Thymine. :)
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer: The bonds that hold atoms together to form molecules are called covalent bonds. They are pretty tough and not easily made or broken apart. It takes energy to make the bonds and energy is released when the bonds are broken.
Answer is (4), (2)
Explanation: did research
hope this helped if not so sorry
