1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexandr1967 [171]
3 years ago
7

22. Different species within a phylum all have the same basic _____. (1 point)

Biology
1 answer:
7nadin3 [17]3 years ago
3 0

Answer:

Different species within a phylum all have the same basic characters, anatomical and functional integrity, common ancestry.

Explanation:

The animals having same phylum but different species have similar basic structural pattern. That means the anatomical features are constructed on the same ground plan. This individuals have similar functional integration. All animals of a phylum work as a functional machines with similar functional integration.

Another important feature is they have common ancestry. Evolutionary study have confirmed all members of  a similar phylum have been derived directly or indirectly from a common primitive ancestry.

You might be interested in
What goes into a leaf? and what goes out?
stealth61 [152]

Answer:

carbon dioxide goes in and oxygen comes out

Explanation:

i have no idea if that's what you're asking im sorry

6 0
3 years ago
Read 2 more answers
Mary lou's cancer began in her skin and then spread to her liver and brain. what type of cancer does mary lou likely have?
mestny [16]

Melanoma is the type of cancer Mary Lou had, Sunburns in adulthood assume to be the mostly associated with melanoma. Melanoma, the most severe type of skin cancer, develops in the cells (melanocytes) that produce melanin — the pigment that gives your skin its colour. Melanoma can be also apear in your eyes and, rarely, in internal organs, such as your intestines.

6 0
3 years ago
​which emotion has been particularly implicated in coronary heart disease?
Naily [24]
Hostility is the emotion particularly related to Coronary Heart Disease. Hostility by definition is having stable attitude of harboring ill-feelings and negative perception towards others and even on events. According to some literature, purely speculative in nature since the researchers weren't able to measure them,such predictive effect of hostility towards CHD is brought about by elevation of stress hormones and other factors.
5 0
3 years ago
What are the factors that contributed to the success of pteridophyte as land plant
Anna35 [415]

Two factors contributed to the success of the pteridophytes: the extreme miniaturization of the gametophytic generation and an important development of the sporophytic generation (development of the tree forms).

Pteridophytes are a group of plants that peaked in the Carboniferous (-300 million years). It is the first great terrestrial plant civilization. These plants would have appeared in the Devonian -400 million years ago, perhaps from certain primitive terrestrial plants which, unlike bryophytes, would have favored the diploid generation on the haploid generation.

Particularly well adapted to terrestrial life, they have created, thanks to the development of tree forms, immense forests whose fossilization is at the origin of coal deposits.

Pteridophytes are at the origin of an evolutionary lineage based on the extreme miniaturization of gametophytic generation and an important development of sporophytic generation, leading to all tracheophytes including current flowering plants. Pteridophytes are well adapted to terrestrial life, however fertilization still requires the presence of water since male gametes are swimmers.

8 0
4 years ago
The one on the bottom
bonufazy [111]
Natural selection or survival of the fittest can cause a major evolution as the species at risk need to stay alive and therefore need to become more adapted to the situation at hand. The species can evolve through generations to become more crafted to the predatorial habits of their predators. If the females are less at risk than the males then the males might evolve to become more protected or if some of the species live in a different situation maybe not even that far away, that can have a big impact on the evolutionary habits of the species at hand.


I hope I'm right
8 0
3 years ago
Other questions:
  • How is an increase in carbon in the atmosphere likely to affect coastal areas such as those in North Carolina?
    11·1 answer
  • 1.
    13·2 answers
  • Tomato plants usually have hairy stems. Hairless stems are present in tomato plants that are homozygous recessive for this trait
    6·1 answer
  • Which of the following is not true concerning the Nereus
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • water makes up a large percentage of the body’s cells. for a cell to remain in homeostasis, there must be a mechanism to control
    5·2 answers
  • URGENT!!!!!!!!-What is the carrying capacity of the graph?<br> OPTIONS:<br> 4<br> 6<br> 13<br> 20
    11·1 answer
  • Is it possible for a son to inherit an X chromosome from his father? Explain why or why not.
    15·2 answers
  • Is smoke related to asthma and air pollution?
    8·1 answer
  • Which of the following describes how an animal welfare activist would feel about raising cows for food and leather?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!