1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zaharov [31]
3 years ago
15

Which thing did Morgan NOT invent? *

Biology
2 answers:
Vesna [10]3 years ago
8 0
B. toilet

hope this helps :)
musickatia [10]3 years ago
7 0
I think it’s B. Toilet
You might be interested in
In corn, the allele A allows the deposition of anthocyanin (blue) pigment in the kernels (seeds), while aa plants have yellow ke
lara31 [8.8K]

Answer:

<h2>A) Yes, 12 mu</h2><h2>B) AaWw</h2><h2>C) 0.25%</h2><h2 />

Explanation:

As given,

Allele A for  blue anthocynin.

aa for yellow kernel;

at  second locus;

W produce smooth kernel,

ww for wrinkled kernel;

Parents as given are:  AaWw and aaww

Progeny are:

blue smooth ( AaWw)= 1447;

blue wrinkle (Aaww)= 169;

yellow smooth (aaWw)= 186;

yellow wirnked (aaww)= 1510

a)

Recombinant progeny are  169+ 186= 355

non- recombinant progeny are = 1447+ 1510= 2957

so recombination frequency (RF)= 346/2957×100= 12.0054%

So a and w are linked genes.

They are 12 mu far away from each other.

b) Blue smooth parent= AaWw.

c) Aaww crossed with  aaWw

progeny are= AaWw, Aaww, aaWw, aaww,

They all are produced in same proportion =0.25% or 1/4.

5 0
3 years ago
The written notation used to represent the elements a compound contains and the relative number of atoms of each element is call
Anni [7]
Sorry I want points
7 0
3 years ago
What specific part of the brain processes nerve impulses from touch and pain receptors?
pogonyaev
TOuch and pain are controlled by different regions of the brain, so I gonna treat these terms separately:

PAIN: one thing seems certain: there is no single "pain centre" whose only activity could account for all facets of pain. In other words, no lobotomy of any particular region of the brain completely removes the pain. So there are many regions that are responsible for pain: The reticular formation and the thalamus (specifically the Deep lemniscal territory) which is responsible for both touch and pain sensations

TOUCH: touch sensation are processed by parietal lobe in the brain cortex (which is also responsible for sight and hearing), and the deep lemniscal territory in the thalamus.

4 0
4 years ago
Water is boiled to make steam to turn a generator to send power to a house. The energy conversions involved include ____________
Marina CMI [18]
Mechanical is one of them
6 0
3 years ago
Which example describes a mutualistic relationship between organisms?
Ulleksa [173]

Answer:

Ants protect a tree on which they feed (Option D)

Explanation:

Mutualistic relationship - relationship between two individuals / species where both involved benefit

A. Predation

B. Predation

C. Parasitism

D. Mutualism

4 0
3 years ago
Read 2 more answers
Other questions:
  • If you drink the mucus of someone with a sinus infection, will you also get the infection?
    7·1 answer
  • A scientific test is called an
    6·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • In eukaryotes, genetic information is passed to the next generation by processes that include mitosis or meiosis. Which of the e
    14·1 answer
  • A group of organisms of the same species that live in the same area at the same time is called ___
    5·2 answers
  • What are formed when minerals replace all or part of an organism?
    13·2 answers
  • Should phosphorus and nitrogen be used to produce corn as a biofuel? Why or why not?
    5·1 answer
  • The following table provides phenotypic data for a population of mammoths living in cold environments based on fossil and DNA ev
    13·1 answer
  • What term BEST describes when evolution of different traits occurs in a recent common related species?
    9·1 answer
  • L24.2 Quiz: Enzyme Action: How Clean Is Your Laundry?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!