Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
<h2>Recessive to
</h2>
Explanation:
1. As given here, both parents are black, and their 247 progeny out of 333 are black, it clearly indicates that 3/4 progeny is parental phenotype and 1/4 is different type.
2. This clearly show that both parents are heretogyzous, one allele is dominant and one is recessive.
3. Here black is dominant over blue.
4. Dominant allele express them-self in dominant homogyzous as well as heterogyzous condition.
Light is to find the distance between planets called light years.
Answer: Bam
Explanation: Scientists are able to understand Earth's interior by studying seismic waves. ... Seismic waves travel at different speeds when they pass through different types of material, so by studying seismograms, scientists can learn a lot about Earth's internal structure.
Answer;
-Sodium
Because Andy has high blood pressure and heart disease, he must lower his intake of Sodium.
Explanation;
-Eating substances rich in sodium such as salt raises the amount of sodium in the bloodstream and wrecks the delicate balance, reducing the ability of the kidneys to remove the water.The result is a higher blood pressure due to the extra fluid and extra strain on the delicate blood vessels leading to the kidneys.
-Therefore, for an individual with high blood pressure and heart disease like the case of Andy, he or she must lower the intake of sodium.
