It is believed that this happens because some signals that regulate development are the same between different species and because <span>they share ancient genes. </span>These ancient genes are expressed during a middle "phylotypic stage" of embryonic development for all species.
For example, human and animal embryos go through very similar stages of early development and share similar features such as tails and gill-like structures. The major difference appears to be how long it takes to reach each of these same stages.
Do you have a question here?
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
He was C Determined This is because he kept on trying Hope this helps
The cell's nucleus contains chromosomes made from long DNA molecules. The diagram shows the relationship between the cell, its nucleus, chromosomes in the nucleus, and genes.
