1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Law Incorporation [45]
3 years ago
8

What are regions of DNA that code for proteins called?

Biology
1 answer:
andrew11 [14]3 years ago
6 0

Answer:

C - Genes

Explanation:

Hope this helps :)

You might be interested in
Specialized cells are found only in
SashulF [63]

Answer: O many celled organisms

Explanation:

3 0
3 years ago
Is uranium a non renewable resource
Trava [24]

Uranium is not a renewable resource.


Hope this Helps!!!

5 0
4 years ago
What is the force that a person applies to a machine
riadik2000 [5.3K]

I believe Mechanical Force is the force you are looking for

5 0
3 years ago
Read 2 more answers
Small membrane-bound sacs that move products into, out of, and within a cell are called __.
blondinia [14]

Answer:

A vesicle is a small, membrane-bound sac that transports substances in cells. The ER moves proteins and other substances within eukaryotic cells.

Explanation:

HOPE THAT HELPS

5 0
3 years ago
Help<br> this is expected by 8:30
NNADVOKAT [17]

DNA is a nucleic acid molecule that undergoes a replication process to form a new daughter strand. The blue segment is the parental strand, and the yellow is the daughter strand.

<h3>What is replication?</h3>

Replication is the process of the central dogma that duplicates the copy of the parent strand into new daughter strands. The two helixes of the parent strand get separated to make the complimentary copy of the new strand.

The daughter DNA is semi-conservative and are complementary structure made from the duplication of the parent strand with the help of the replication enzymes.

Therefore, the daughter strands are the semi-conservative copies of the parental strand.

Learn more about replication here:

brainly.com/question/16464230

#SPJ1

7 0
2 years ago
Other questions:
  • What is it called when bacteria take in DNA from their environment?
    7·1 answer
  • Which is the main organ of the excretory system?
    12·2 answers
  • • What characteristics are used to classify viruses?
    9·1 answer
  • What type of metamorphic rock does shale turn into when it is exposed to intense heat and pressure?
    13·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Please help- Which body system includes protection of internal organs and blood cell formation?
    6·2 answers
  • What kind of molecule is depicted here
    13·1 answer
  • 2. Explain how plants can move water upward. Include the terms cohesion, adhesion, and capillary
    7·2 answers
  • Which describes the process of fermentation?
    14·1 answer
  • Do you think that the plastic skin cell is living or non-living? Why?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!