1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
masha68 [24]
3 years ago
11

What are metric units

Biology
1 answer:
jarptica [38.1K]3 years ago
6 0
<span>Metric Units review the size of millimeters, centimeters, meters, and kilometers and how to convert between them.

Hope this helps!</span>
You might be interested in
Which of the following best describes the main function of a cell’s nucleus?
BaLLatris [955]
A nucleus is the cell's control centre but the cell membrane is what controls what comes in and out depending whether it is selectively permeable or semi permeable; therefore, the answer would be C because it take control and manages everything in the cell
7 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
4 years ago
An error sometimes made by beginning biology students is called the "Adaptationist Fallacy" wherin a trait observed in a populat
aleksley [76]

Answer:

The Adaptationist Fallacy can prove very costly to biologist who are assuming it wrong according to the function in the environment. Let us have an example of the phenotype of wheat diploid breed that produces non-bearded grains variety, but we cannot assume it as a beneficial phenotype without further extensive research. After research, we came to know that there is also a major hexaploid bearded variety, that produces more number of grains. That's how, the Adaptationist Fallacy may prove fatal if we have assumed diploid as a major beneficial phenotype.

4 0
3 years ago
)What type of questions cannot be solved by scientific methods?
lana [24]
Hi!

Questions that we cannot answer with science are going to be ones which are subjective, or, opinion related.

For example, could we follow the scientific method in order to successfully see that Mandy's favourite colour is 'blue' and her grandma's favourite food is 'pizza'? 

Well... I... I guess, but... It doesn't make sense! These have nothing to do with science, as they are all just opinionated! 

Hopefully, you get the picture. =)
8 0
4 years ago
What region of the brain is known as the "relay center" for ALL sensory information
9966 [12]

The answer is A, Thalamus.

4 0
3 years ago
Other questions:
  • Why does the Owl Butterfly have a pattern of an owls face on it's wings
    10·2 answers
  • Who developed the two-part naming system scientists use today to classify newly found organisms?
    5·1 answer
  • Special filtered masks are often required when caring for a client with known or suspected tuberculosis
    14·1 answer
  • A solution that causes a cell to swell because of osmosis.
    15·2 answers
  • The human eye has three types of cone cells. Damage to any one of the types of cone cells doesn’t cause total blindness because
    13·2 answers
  • A neutral atom with 12 protons hasa. 18 electrons.b. 6 electrons.c. 12 electrons.
    7·1 answer
  • The Paleozoic era translates as the?
    9·1 answer
  • Why is it incorrect to say plants “breathe” Carbon dioxide (CO
    7·1 answer
  • I need help with 7 help please I will give brainliest
    11·1 answer
  • The condition in which an organism whose cells have either gained or lost a chromosome.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!