Answer No 1)
<em>The correct option is D) The two species have a common ancestor</em>
Homologous structures can be described as organs or other structures which are similar in different organisms. These structures might not perform the same function, but are similar in their making. This similarity of structures between organisms of different species suggests that there might be a common ancestor for these organisms.
Answer No 2)
<em>The correct option is B) Y, Z, X</em>
The organism Y is the most similar to the worm because it has all the amino acid sequence similar to the portion shown for the worm, except for a single amino acid which is S. The sequence Z has more similarities with the amino acid sequence for the enzyme from a worm than the sequence of the organism X. Hence, the correct option is B.
Answer No 3)
<em>The correct option is A) Sequence the same gene in both species to compare their similarity.</em>
The process of DNA sequencing has now made it possible to determine the evolutionary histories among organism by comparing the DNA sequence of one organism to the DNA sequence of another organism. The organisms having similarities in the DNA sequence clearly determine the evolutionary relationship between any organisms.
Answer No 4)
<em>The correct option is C) Vestigial</em>
Vestigial structures can simple be described as structures which had some function to perform in the ancestors but are not known to perform any function in organisms known today. These structures show that evolution might have caused these structures to non- performing structures as they were of less benefit to the organisms present now on Earth.
I think you mean Round could be RR or Rr (round is dominant to wrinkled)
R=round
r=wrinkled
RR would be round phenotypically
Rr would be round phenotypically
To determine if they are RR or Rr you should perform a backcross with a wrinkled mutant!
I put a picture to demonstrate this.
If they are RR then if you cross with rr you would only get phenotypically Round pea plants.
If they are Rr then if you cross with rr you would get 50% round and 50% wrinkled. Any wrinkled? Definitely the heterozygote Rr!!
(X-4)(X-5)......................
Answer:
CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA
Explanation:
Cytosine pairs with Guanine.
Adenine pairs with Thymine.
Topography is occupied with how individuals and societies identify with the physical environment. The biggest environment of which we are part is the biosphere. The biosphere is the part of the world's surface and its environment where living beings exist. It has additionally been portrayed as the life-supporting layer that encompasses the Earth.
The biosphere we live in is comprised of biomes. A biome is a vast topographical district where certain sorts of plants and creatures flourish.
Operant molding is essentially an aftereffect of gaining from the results of the boost. It is an attribute that has advanced through time with numerous life forms.
