1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Keith_Richards [23]
3 years ago
7

Im thinking the answer is bacteria but I'm not sure

Biology
1 answer:
Zina [86]3 years ago
3 0

Answer:

Yes you are right

Explanation:

I did it in test

You might be interested in
Which of these is an example of recycling?
CaHeK987 [17]

A and D comes under recycling while B is reuse and C is reducing

5 0
3 years ago
Humans are not the only animals that cause air pollution.<br> A. True<br> B. False
garri49 [273]
The answer is true, pigs cause air pollution by releasing methane into the air.<span />
4 0
4 years ago
Help meh pweeese or you be a sUuUsSyY BaKaAaA
wariber [46]

Answer:

ok help you with what? I got you if u give me brainliest

Explanation:

6 0
3 years ago
Read 2 more answers
What is menstruation, and how is the process triggered during each "monthly" cycle?
ValentinkaMS [17]
The ovary brings the egg to the Fallopian tube then the egg goes to the uterus then a lining is made then it is shed after 4 to 5 days after ovualation<span />
6 0
4 years ago
Which neural center in the limbic system helps process explicit memories for storage?
aev [14]
Hippocampus

It is a small part of the brain located on the medial temporal love and forms important part of the limbic system, these are the regions that regulates emotions. This is also associated with memory, spatial navigation, consolidation of information. Damage to this area can cause memory loss, difficulty establishing memory . In Alzheimer's disease hippocampus is one of the first regions in the brain to be affected.
7 0
3 years ago
Other questions:
  • How do breeders produce genetic variations that are not found in nature?
    7·1 answer
  • How do food webs differ from food chain?
    15·2 answers
  • Christy notices that a certain kind of moth flies to the light on her porch. Which behavior is the moth exhibiting? A. Taxis B.
    5·1 answer
  • What creates lava and how does lava become molded
    12·2 answers
  • Which Organ Helps Digestion but He's Not Part of the Digestive Tract
    14·1 answer
  • What is sensorineural?
    9·1 answer
  • A pea plant purebred to produce round yellow peas is crossed with a plant purebred to produce wrinkled green peas. Round pea sha
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Do you think it is likely that the tea leaves used in beverages today are were centuries ago in India or China?
    13·1 answer
  • What are the benefits of regeneration to the life of a tropical forest​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!