1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sineoko [7]
2 years ago
6

Seminiferous tubules are the site of sperm storage. O True O False

Biology
2 answers:
Sever21 [200]2 years ago
8 0
Are you being serious?
Nataly_w [17]2 years ago
5 0

Answer:

is this an acttual question?

Explanation:

You might be interested in
In the skeletal system, which are the two main tissues responsible for structural support in the body?
stepladder [879]

the two main skeletal systems to support the tissue of the body is bone and cartilage

hopefully this will help

3 0
3 years ago
If the concentration of salt in the fluid surrounding cells decreases and the concentration of other solutes remains constant?
svetoff [14.1K]

Answer:

The cell will swell.

Explanation:

The cells react distinctly when placed in different solutions like hypertonic, isotonic and hypotonic solutions. In the mentioned question, that is, in the fluid surrounding the cells, the concentration of salt reduces, which makes the solution hypotonic. Hypotonic solution exhibit high water potential and low solute concentration.  

This makes the water move from the hypotonic solution to the inside of the cell as the osmotic movement occurs from high solvent concentration to low solvent concentration, thus, swelling of the cell takes place.  

7 0
3 years ago
Can someone please help me?
vaieri [72.5K]
A movement of alleles resulting from migration. I hope I helped
7 0
3 years ago
Read 2 more answers
Which is true regarding color blindness?
777dan777 [17]
Answer will help you.

When it involves one sets of cones it is an inherited recessive trait.
4 0
3 years ago
What is evolution? brainliest
Sedaia [141]

Answer:

Evolution is change in the heritable characteristics of biological populations over successive generations.

Explanation:

3 0
2 years ago
Other questions:
  • The first organism in a food chain is always a(n)
    9·1 answer
  • What is one of the advantages,<br>of reproducing sexually versus<br>asexually?​
    13·1 answer
  • How is dna used to make up polypeptides, make sure it sounds like my words
    15·1 answer
  • what is the most important responsibility of individual in creating a safe environment especially on public health. ​
    6·1 answer
  • Explain the energy flow in the ecosystem?
    14·1 answer
  • Please help is a b c or d ?​
    11·2 answers
  • What are the most diverse ecosystems on Earth?
    11·2 answers
  • What is the process which scientists grade the work of other scientist before published?
    11·1 answer
  • Which of the following defines a genome?
    5·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!