Answer:
Some animals have pouches to carry babies.
The babies are warm and are also protected from danger in their mother's pouch. Some animals have pouches to carry babies. Kangaroos are called marsupials because they have a special pouch for their babies.
Explanation:
I hope it helps you btw Can I get a brainliests please ☺️
Answer:
You may have heard that your heart skips a beat when you sneeze, but that's a myth. Electrical signals that control your heart rate aren't affected by the physiological changes that happen when you sneeze. But the heart may get delayed for a second or two before resuming its regular rhythm.
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
