Starting billions of years ago, in what way did algae change the atmosphere of

Biology

2 answers:

docker41 [41]3 years ago

6 0

Answer:carbon dioxide was converted to oxygen

Explanation:

Jobisdone [24]3 years ago

5 0

In 1990 it change our atmosphere and it started growing on trees and other thing to

You might be interested in

Arboreal animals are animals that _______. a. rely on trees for food b. live in trees c. are harmful to trees d. none of the abo

sveticcg [70]

Answer:

The correct answer is B) lives in trees

Explanation:

Hope this helps :)

4 0

2 years ago

Why do cells undergo mitosis?<br><br> HELP PLEASE

-Dominant- [34]

Cells undergo mitosis because there must be a process in which the nucleus is divided in order for there to be a successful reproduction for cells.

4 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved