1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NARA [144]
2 years ago
12

~True or False~

Geography
1 answer:
nika2105 [10]2 years ago
7 0

Explanation:

1-true

2-false (mainly aztecs used this technique)

3-true

4-true

5-false (we don't see slavery like we used to so false)

6-false (1808-1826 is when they started to become independent)

(hope this helps. I would say research 2 and 5 if you still want better answer. Have a great day!)

You might be interested in
How is climbing a very tall mountain similar to driving from the southern United States to northern Canada?
Andru [333]

Answer:

Both involve a change in climate conditions

Explanation:

they change often and the climate is in conditions to classify climate regions

4 0
2 years ago
Help me pls I’m giving brainlest
Jlenok [28]

Answer:

c.

Explanation:

7 0
2 years ago
Read 2 more answers
Tropic maps are easily recognized by their____
daser333 [38]

Answer: contour lines.

Topographic maps are easily recognized by their contour lines.

7 0
3 years ago
Read 2 more answers
Beach erosion is generally the result of what physical process?
Paladinen [302]

The correct answer is - B) wave erosion.

The beach erosion is a direct result of the wave action on the coastline. The waves are very powerful when it comes to erosion, and this is because they have big power, and also the chemical components of the water that are very effective too.

The sheer power of the waves contributes to the direct breaking of the rocks into smaller pieces over time, while the water itself, is reacting with the rocks on a chemical level and slowly decomposes them. As the rocks are getting smaller and smaller because of the erosion, the tiny fractions of sand particles are forming the beaches along the coastlines.

6 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • This natural resource supports the economy of many nations in the region. diamonds oil salt soil
    15·1 answer
  • Drag each label to the correct location on the table. Classify each planet as an inner planet or an outer planet. Planet A has 6
    7·1 answer
  • Which type of land surface will most likely absorb the greatest amount of incoming solar radiation?
    8·1 answer
  • What is the difference between space satellites and space probes?
    6·1 answer
  • Explain how a spit is formed.
    7·2 answers
  • What are the two major concerns over using fossil fuels for energy?
    15·1 answer
  • When we speak of characteristics in geography, we're referring to
    8·1 answer
  • Pressure is a scalar quantity give reason​
    6·2 answers
  • Q.3 What would be the economic impact if a stopped importing goods and commodities?
    15·1 answer
  • When people who speak a given language migrate to a different location and become isolated from other members of their group.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!