I do believe the answer is B because since it is going through each phase, the DNA strand will continue to adjust itself as the cell moves making the strands split allowing themselves to create copies. Since DNA has to be connected with another strand that will fit, it will be able to multiply itself based on the pieces that are missing
The right answer is Damselfish
The damselfish is a species of herbivorous fish that contributes to a balance of marine plants by eating algae among corals, to prevent the proliferation of algae and to promote the growth of coral reefs. The parrotfish (Scaridae) or "coral cleaner" has the same similarity of the diet with the same equilibrium that the damselfish offers, but it can also feed on coral.
Decomposers are essential in breaking down organic matter into useful ones. For the nitrogen cycle, they break down bodies of dead organisms turning it into ammonia. Also, some bacteria break down nitrates turning into nitrogen which goes back to air.
Answer:
The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.
Explanation:
Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.
If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:
<u>Exercise 1:</u>
- DNA ATACGAAATCGCGATCGCGGCGATTCGG
- mRNA UAUGCUUUAGCGCUAGCGCCGCUAAGCC
- CODON UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
- AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
- Amino acid Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser
<u>Exercise 2: </u>
- DNA TTTACGGCCATCAGGCAATACTGG
- mRNA AAAUGCCGGUAGUCCGUUAUGACC
- CODON AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
- AntiCODON UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
- Amino acid Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
Iris is most likely being negatively stereotyped as being gifted.
Option D
<h3><u>
Explanation:</u></h3>
Many students who have proven to be gifted intellectually are likely to face struggle and negative feedback from their classmates. This is generally because they believe that the gifted student will get special treatment above the other student. Furthermore, it is evident that gifted students are likely to have different interests than their peers or much deeper knowledge of the common interest. They use terms which peers might not understand, barring them from having an effective conversation.
To maintain a balance in the class, teacher's are trained in a specific field in which they learn how to treat all the students equally, gifted or not. That helps reverse the negative stereotype or bring it down to a minimal level. As for students interacting with each other, several activities are put to place to encourage healthy interactions.
