1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
balu736 [363]
3 years ago
12

Why do kokanee salmon spawn only once?

Biology
2 answers:
Darina [25.2K]3 years ago
5 0

Answer:

A

Explanation:

Constructing passage ways near the dams to allow to salmon to swim around blocked rivers. The construction of dams in rivers has blocked the path of  some salmons returning to spawning grounds. The best way to overcome this is to make the passage ways near the dams to allow salmons to swim in areas which have blocked due to dams. So that salmons can returned to the spawning ground and can spawn which leads to increase in their population.

NikAS [45]3 years ago
4 0

Answer:

Salmon change color to attract a spawning mate. Pacific salmon use all their energy for returning to their home stream, for making eggs, and digging the nest. ... Unlike Pacific salmon, Atlantic salmon do not die after spawning, so adults can repeat the spawning cycle for several years.

You might be interested in
Fish give off ammonia, a base, as a waste. How does this
n200080 [17]

Answer:High pH levels (9-14) can harm fish by denaturing cellular membranes. Changes in pH can also affect aquatic life indirectly by altering other aspects of water chemistry. Low pH levels accelerate the release of metals from rocks or sediments in the stream.

Explanation:

6 0
3 years ago
What achievement does king think Nobel prize committee is recognizing him for
icang [17]

his efforts to fight oppression without violence

7 0
4 years ago
Read 2 more answers
Please answer this question this homework is for today
Elis [28]

Answer:

?????????????

Explanation:

3 0
3 years ago
PLEASE HELP NOW  At which of these convergent plate boundaries are active volcanoes not likely to be located?
sertanlavr [38]

Arabian plate and Eurasian plate is the correct answer.

8 0
3 years ago
How does the size of a eukaryotic organism normally compare to the size of a prokaryotic organism? A. Eukaryotes are usually muc
Nikolay [14]
Your answer should be A: Eukaryotes are usually much larger than prokaryotes.

Eukaryotes can be described as complex, large structured cells, while prokaryotes are simpler, smaller calls.

Hope this helps!
8 0
4 years ago
Read 2 more answers
Other questions:
  • BRAINLIESTT ASAP!<br><br> Why do regions have different climates during the same seasons?
    7·2 answers
  • When an animal cell is placed in a hypotonic solution, _____.
    13·2 answers
  • In the combined processes of glycolysis and cellular respiration is produces
    10·1 answer
  • Who confirmed the three dimensional structure of DNA
    10·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • With respect to adolescence, biology determines:___________.A. neither its beginning nor its ending. B. its beginning, as well a
    8·1 answer
  • A scientist discovers what he thinks is a cell. Which question about this new discovery should the scientist answer first to det
    9·2 answers
  • Someone help pleasesdesereffgfqsgdafge
    9·2 answers
  • What would happen if glycolysis could not happen in a cell?
    11·1 answer
  • Darren is using tongs to carefully lift and move a beaker. What most likely happened before Darren moved the beaker?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!