1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gulaghasi [49]
3 years ago
13

Which era is known for having

Biology
2 answers:
luda_lava [24]3 years ago
8 0
It’s perame brain because of the prevent
Oksanka [162]3 years ago
4 0
I’m pretty sure it’s the permBain era
You might be interested in
what happens to the two small balloons inside as you pull down the big balloon at the bottom of the model?​
xeze [42]

Answer:

The lower pressure balloon will expand. Figure 2 (above left) shows a typical initial configuration: the smaller balloon has the higher pressure. So, when the valve is opened, the smaller balloon pushes air into the larger balloon. It becomes smaller, and the larger balloon becomes larger.

Hope this is helps out

Explanation:

6 0
3 years ago
A process of change in a population through genetic variation over time​
vladimir2022 [97]

Answer:

Search Results

Featured snippet from the web

Evolution is a process that results in changes in the genetic material of a population over time. Evolution reflects the adaptations of organisms to their changing environments and can result in altered genes, novel traits, and new species.

Explanation:

5 0
3 years ago
Read 2 more answers
A scientist discovers a new organism that is related to clownfish. What can the scientist discover by using molecular clocks?
Sergeu [11.5K]
The amount of time that the 2 species have been evolving apart??
5 0
3 years ago
Read 2 more answers
What are two other abiotic factors that could also be studied to help determine the health of the streams in the two watersheds?
Marta_Voda [28]

I'm not completely sure about this answer because our unit on that was very short. So please don't be upset if its incorrect.

The answer is phytoplankton and water depth, because in order for any ecosystem to survive they need the producer population (Plants)

Middle School

Basic Rank

7 0
3 years ago
Which best compares and contrasts red blood cells and white blood cells?
Jet001 [13]

Answer:

The correct answer is both are produced in red bone marrow.red blood cells transport oxygen while white blood cells protect the body against disease.

Explanation:

Red blood cells or RBC contain hemoglobin protein that helps in the transport of oxygen and carbon dioxide to and from our body.

   Where as white blood cells provide defence to our body against various invaded pathogens.There are many types of White blood cells such as eosinophyll, basophyll,neutrophyll,monocyte and lymphocyte.

  Both RBC and WBC are generated from red bone marrow.

8 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is the relationship of geoshphere and mantle
    8·1 answer
  • What happens to proteins dissolved in that water when you heat it to 100°C?​
    10·1 answer
  • HELP? Use the description of each cell to determine which phase of the cell cycle the cell is in. Explain your reasoning.
    8·1 answer
  • Which of the following vectors holds the largest pieces of DNA?
    7·1 answer
  • I need help with these two questions!!!
    7·1 answer
  • PLEASE ANSWER ILL GIVE YOU BRAINLIEST
    13·1 answer
  • Why did land animals evolve back to aquatic environments?
    6·2 answers
  • My pet mouse had babies and then it ran away and i dont know what to do
    5·1 answer
  • 14. What happens during the development stages that happen between a
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!