1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mash [69]
3 years ago
6

Pls help me??????????

Biology
1 answer:
castortr0y [4]3 years ago
5 0

Answer:

Your answer is B). Massive stars undergo a supernova at the red giant phase.

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Imagine a protein that has been engineered to contain a nuclear localization signal, a nuclear export signal, a C-terminal perox
Masja [62]

Answer:

This sequence would target the peroxisome

Explanation:

  • When the protein  is made it will be able to target several organelles in the cell
  • However, the C-terminal sequence is the last sequence transcribed and when the protein is complete this sequence will be the sequence used for targeting the specific organelle
  • in this case, the C-terminal sequence targets the peroxisome
8 0
3 years ago
Fungi are classified based upon
Softa [21]
Fungi are classified based upon how they reproduce. The rest of the factors do not include anything of their classification.
5 0
3 years ago
This is the cultivation of animals, plants, fungi, and other life forms for food, fiber, biofuel, drugs and other products used
blondinia [14]

Agriculture

Explanation:

Agriculture can be defined as the cultivation of animals, plants, fungi, and other life forms for food, fiber, biofuel, drugs and other products used to sustain and enhance human life.

  • The etymology of the word can be traced to Latin; Ager-field, cultura-growing.
  • Agriculture provides food that is used to sustain life on earth.
  • It involves solely the cultivation of plants and organisms for nourishment.
  • Some industries thrives on agricultural products and are referred to as Agro-allied industries.
  • It is an art and science of cultivating livestock and plants for use.

Learn more:

Human impact on rainforest brainly.com/question/3995505

#learnwithBrainly

3 0
4 years ago
Read 2 more answers
How many combinations of genotypes are possible for the coat coloration of rabbits which is governed by three alleles?
Dmitriy789 [7]

Answer:

b) 6

Explanation:

There are three different alleles (A,B,C) which are responsible for coat coloration but only combination of two can move forward because there are two loci at every homologous pair of chromosomes.

Thus, six combinations can be formed as AA, AB, AC, BB, BC, CC.

7 0
3 years ago
Other questions:
  • An infant admitted to the hospital with an acute rotavirus infection is having frequent diarrheal stools. on assessment, the nur
    15·1 answer
  • Qualities of a mineral that classify it as ore
    13·2 answers
  • The process of turning molecules that are ingested into forms that are compatible with the organism is _________.
    12·1 answer
  • ____ is the energy storage compound found in animals and ___ is the energy storage compound of plants.
    13·1 answer
  • What is the function of the NADH/FADH molecules?
    11·1 answer
  • Expressiviy refers the percentage of people who display at least some degree of expression of a mutant genotype
    5·1 answer
  • Deep vein thrombosis
    7·1 answer
  • Identify the muscle marked by the star (*): *<br> *
    13·2 answers
  • 18. Which activity is not a response of human white blood cells to pathogens?
    12·1 answer
  • All the children and grandchildren are coming to Mrs. Chalmers’ house for a big Thanksgiving dinner, and she wants everything to
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!