1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pishuonlain [190]
3 years ago
13

How does compaction lead to lithification

Biology
1 answer:
Reptile [31]3 years ago
7 0

Answer: ok its becase

Explanation:

Lithification is the process by which sediments combine to form sedimentary rocks. Compaction is a consolidation of sediments due to the intense pressing weight of overlying deposits. With compaction, sediment grains get squished together, reducing the size of the original pore space that divided them.

Hope it helps and can i get brianlest

You might be interested in
Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
Svetllana [295]

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

8 0
3 years ago
What's an advantage of using a light microscope instead of an electron microscope
lukranit [14]

While light microscopy magnifies objects up to 2000x (two-thousand times), electron microscopy is a much higher resolution study of microscopic objects, magnifying objects up to 10,000x. However, light microscopes do offer some advantages over electron microscopes:

1.Ease of use in a laboratory

2.The ability to keep specimens alive for extended periods

3.Colors images - Images can be rendered in a variety of colors in light microscopy,

8 0
3 years ago
Can you think of any animals that undergo metamorphosis ?
Angelina_Jolie [31]

Answer: Lobsters, beetles, butterflies, flies, some fish and wasps

7 0
3 years ago
Read 2 more answers
Please I need help! This is due today! ​
Oxana [17]

Ur Grades So Poor Ur Moms Gonna Beat U Up

Explanation:

LoL

7 0
3 years ago
What pigment is derived from vitamin a
g100num [7]

Retinol undergoes oxidation to produce retinal, which when combined with the protein opsin results in the formation of the light-sensitive pigment rhodopsin. You can see in black and white because rhodopsin is the pigment that gives you night vision.

<h3>What pigment is created using vitamin A?</h3>

Rhodopsin, also known as visual purple or the light-sensitive pigment found inside rod and cone cells of the retina, requires the retina as a structural component in order to function.

Yellow, orange, and red fruits and vegetables are colored by a pigment called carotenoids. Some carotenoids can be transformed into vitamin A by your body. The two sources of vitamin A are as follows: Fish, liver, dairy products, eggs, and organ meats are all sources of preformed vitamin A.

To know more about pigments visit:

brainly.com/question/26722048

#SPJ1

3 0
1 year ago
Other questions:
  • What kind of questions would you ask, if you are provided with the following materials: Sugar, stir stick, access to warm or col
    6·1 answer
  • 6. Red blood cells are made in the marrow. What two systems are
    14·1 answer
  • How does a nerve impulse pass along a neuron?
    5·1 answer
  • Which of the three graphs shown in figure 17-5 might show a population of birds with members that specialize in different types
    5·2 answers
  • In fruit flies, the gene for eye color is located on the X chromosome, and the red eye allele (R) is dominant
    5·1 answer
  • Hope this help good luck
    5·1 answer
  • The members of an animal community are usually similar in
    5·2 answers
  • Which of the following statements is true?
    6·2 answers
  • Which individual is most clearly in need of diagnostic testing for lung cancer?
    6·1 answer
  • Hemophilia is an example of
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!