1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oduvanchick [21]
3 years ago
11

Are mixed people still poc?

Biology
1 answer:
serious [3.7K]3 years ago
8 0

Answer:

I think so.

Explanation:

You might be interested in
What is likely the greatest cause of species extinctions this century
SVETLANKA909090 [29]

Answer:

Habitat destruction and degradation, inflicted as humans expand our activity further into the last wild places, is a powerful engine for extinction.

Explanation:

8 0
4 years ago
Read 2 more answers
PLSS Help
Ivan
A protist has a nucleus inside of it to make it a Eukaryote, if it had no nucleus it would be consider a Prokaryote
8 0
3 years ago
mitochondria or submitochondrial particles can carry out the following coupled reaction: 2 cyt c (red) 1/2 o2 adp pi -> 2 cyt
shutvik [7]

Answer: Complex IV, also known as cytochrome c oxidase, oxidizes cytochrome c and transfers the electrons to oxygen, the final electron carrier in aerobic cellular respiration. The cytochrome proteins a and a3, in addition to heme and copper groups in complex IV transfer the donated electrons to the bound dioxygen species, converting it into molecules of water. The free energy from the electron transfer causes 4 protons to move into the intermembrane space contributing to the proton gradient. Oxygen reduces via the following reaction:

2 cytochrome c(red) + ½O2 + 4 H+(matrix) -> 2 cytochrome c(ox) + 1 H2O + 2 H+(intermembrane)

Explanation:

In the electron transport chain (ETC), the electrons go through a chain of proteins that increases its reduction potential and causes a release in energy. Most of this energy is dissipated as heat or utilized to pump hydrogen ions (H+) from the mitochondrial matrix to the intermembrane space and create a proton gradient. This gradient increases the acidity in the intermembrane space and creates an electrical difference with a positive charge outside and a negative charge inside. The ETC proteins in a general order are complex I, complex II, coenzyme Q, complex III, cytochrome C, and complex IV.

7 0
2 years ago
Mendel observed that some genetic traits seemed to mask others in the pea plants, and used the term ___ to describe these traits
Free_Kalibri [48]
Mendel called these traits that masked others "dominant".
3 0
4 years ago
The water on the Earth today has been sustaining life for millions of years. Please select the best answer from the choices prov
amm1812

The answer is that it is True. It is true because the earth has been around for millions of years, and water has been around for just as long. hope this answer helps!

5 0
4 years ago
Read 2 more answers
Other questions:
  • Eli is an extravert. there is some evidence that people like eli seek stimulation because their normal brain arousal is relative
    9·1 answer
  • Which statement describes how technology has increased our information on Mars? The Curiosity rover found sulfur compound in roc
    14·1 answer
  • Prokaryotes that are round are called spirochetes. <br> a. True<br> b. False
    11·1 answer
  • Cancerous cells form as a result of...
    8·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • A part of an ecosystem that can restrict the growth of a population is referred to as
    14·2 answers
  • Which epidermal layer marks the transition between metabolically active cells of lower layers and the dead layers of keratinocyt
    12·1 answer
  • (50) points for this q
    5·2 answers
  • Cells that respond to peptide hormones usually do so through a sequence of biochemical reactions involving receptor and kinase a
    13·1 answer
  • Which best represents an example of carbon fixation?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!