During transcription, a fragment of DNA is used as template to synthesize a complementary mRNA molecule. Subsequently, this mRNA is in turn used as a template to synthesize a protein by a process called translation.
In this case, the complementary mRNA sequence is:
- 3´GAGAGGGGGCGCCCCCGACAUGAUAGUACGCAGCAGAGCCAAUUAAA 5´
- Transcription is a molecular mechanism by which a fragment of DNA (e.g., a gene) is used as a template to synthesize a complementary RNA sequence, usually a messenger RNA (mRNA) sequence.
- Subsequently, this mRNA sequence is then used as a template to produce a polypeptide chain in the ribosomes by a process called translation.
- According to the base complementarity rules, Adenine always pairs with Thymine, whereas Guanine always pairs with Cytosine.
- In RNA, Thymine (T) bases are replaced by Uracil (U).
Learn more in:
brainly.com/question/837295?referrer=searchResults
Answer: The generally accepted parts of recent cell doctrine include: All known living things are made of one or more cells. All living cells arise from pre-existing cells by division. The cell is that the fundamental unit of structure and performance all told living organisms. I hope this helps :)
In a chemical reaction, the atoms and molecules that interact with each other are called reactants. In a chemical reaction, the atoms and molecules produced by the reaction are called products. In a chemical reaction, only the atoms present in the reactants can end up in the products.
Hopefully this helps!
(D)an atom can join with other kinds of atoms.
Basically he explained what a molecule is.
In general, the process responsible for the growth and repair of human tissue is the healing process, which takes place in three phases.
1. inflammatory response. Injured tissues release chemicals that draw resources to the area, alert the body that damage has occurred and inhibit function to prevent further injury.
2. Repair phase. Once injured area is walled off and debris removed, construction to replace or repair injured tissue begins. New blood vessels grow in the injured area maximizing transport within tissue.
3. Remodeling phase. Construction of permanent tissue , typically strong scar tissue made from dense network of collagen fibers.
Looking at it from cell level, the process of mitosis is actually taking place during healing.
Mitosis is used for growth and repair and produces diploid cells identical to each other and to the parent cell.
New cells are needed throughout life. These are for growth and replacement of damaged or worn out tissue. The body obtains such through the process of mitosis.
