1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vova2212 [387]
3 years ago
12

Explain why two blond, straight faired parents cannot give birth to a brown, curly haired child.

Biology
1 answer:
dexar [7]3 years ago
6 0

Answer: genetics!!!!!

Explanation: If you both have blonde hair you wouldnt be able to give to a brown hair child!!! If you both have straight hair then your child shouldn’t  have curly hair , it’s not possible.

You might be interested in
What is the colorless, odorless gas that binds to red blood cells causing the body not to get the oxygen it needs?
Juliette [100K]

Answer:

Therefore,when carbon monoxide is present,it blind to hemoglobin preferentially over oxygn.As a result,oxygen cannot blind to hemoglobin ,so very little oxygen is transported through the body carbon monoxide is a colorless odorless gas and is therefore difficult detect.

7 0
2 years ago
What are the levels of ecology, from the smallest level to largest level?
Vadim26 [7]

Answer:

The levels, from smallest to largest, are: molecule, cell, tissue, organ, organ system, organism, population, community, ecosystem, biosphere.

Explanation:

8 0
3 years ago
What is biology ? please help me to do my hw
mamaluj [8]

Biology is the study of living thing

5 0
3 years ago
Read 2 more answers
Stress" is defined as _______.
shusha [124]
I think the answer is B, the interpretation of specific events as threatening or challenging. According to Hans Selye stress is a body's nonspecific response to any demand made on it, physical arousal to events seen as threatening, and mental arousal to events seen as challenging. However, there are effective strategies to cope with stress which include a sense of humor, relaxation, social skills, and social support.
4 0
3 years ago
While most bacteria are eliminated by antibiotics, some can possess mutations that are resistant to antibiotics, leading to more
Papessa [141]

Answer:

The trait must make the individual more fit to survive. True

Explanation:

Darwin proposed that genetic variations are present in natural populations. Some genetic traits become beneficial under the changed environmental conditions. The organisms with these genetic traits are able to survive and reproduce better than the organisms that lack them. This results in an increased proportion of the beneficial genetic traits in the population over generations as the individuals having those traits reproduce more.

The presence of antibiotic resistance is a beneficial genetic trait that allows bacteria to survive in the presence of antibiotics. Natural selection favors the bacterial having antibiotic resistance and increases their proportions in the population over generations.

3 0
3 years ago
Other questions:
  • WILL GIVE BRAINLIEST! (Image attached)
    9·2 answers
  • What organisms can get up to 10 centermeters in size
    5·1 answer
  • Chimps, unlike humans, are limited to using nearby natural materials to make a tool to gather the stinging ants. In your own wor
    14·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which of the following facts supports the argument that a pregnant cow should be fed more in its last trimester?
    9·1 answer
  • In which biome do herds of caribou and reindeer migrate in and out? A. tropical rainforest B. desert C. Mediterranean/chaparral
    15·2 answers
  • I WILL GIVE BRAINLIEST IF SOMEONE ANSWERS WITHIN FIVE MINUTES!!!
    7·1 answer
  • A student walls 2 km in 30 minutes. What is the student's average speee in km/h
    6·1 answer
  • Why does a phospholipid on the cytoplasmic side of the cell membrane rarely flip to the extracellular side if both environments
    15·1 answer
  • Photosynthesis ceases when leaves wilt, mainly because A. the chlorophyll in wilting leaves is degraded. B. accumulation of CO²
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!