Need mRNA AMINO ACIDS 1.AATACGGGGGCGTAACCACTA 2. GCTAGTACGTGCACATTAGAA

Biology

1 answer:

vovangra [49]3 years ago

4 0

Answer:

1.AATACGGGGGCGTAACCACTA

mRNA: UUAUGCCCCCGCAUUGGUGAU

Amino Acid: Leu, Cys, Pro, Arg, Ile, Gly, Asp

2.GCTAGTACGTGCACATTAGAA

mRNA: CGAUCAUGCACGUGUAAUCUU

Amino Acid: Arg, Ser, Cys, Thr, Cys, Ans, Leu

Explanation:

I abbriviated the amino acids. If you ever need to find the mRNA of DNA, apply the smae rules to the mRNA but A goes with U.

RNA : Replace Thymine (T) with Uracil (U)

To find amino acids: Use an mRNA codon

You might be interested in

A patient is admitted with lower abdominal pain and nausea. the nurse performing the initial assessment notes that the patient's

myrzilka [38]

A patient is admitted with lower abdominal pain and nausea. the nurse performing the initial assessment notes that the patient's abdomen is distended and firm, and hypoactive bowel sounds are present. the patient has not had a stool for 3 days. the nurse will contact the provider, who will most likely perform diagnostic tests.

7 0

3 years ago

What distinguishes bogs, marshes, and swamps from each other?

vladimir2022 [97]

The answer is b. Swamps are deeper and have a larger proportion of surface water than marshes, and bogs have acidic groundwater.

Bogs, marshes, and swamps are types of wetlands. Swamps and marshes are mineral soil wetlands. Swamps are deeper and with a larger proportion of surface water than marshes. Usually, swamps develop from marshes that fill in. Bogs are organic soil wetlands. They are acid areas with acidic groundwater.

5 0

3 years ago

Read 2 more answers

I need help please!!

Sliva [168]

Answer:

Prokaryotes and Eukaryotes are two types of cells with similarities and differences. Eukaryotes are plant cells and animal cells. They are mostly found in multi-cellular organisms. Prokaryotes are usually single-celled organisms and have a tail. Those are the examples that I remember, but there are way more similarities and differences. I hope this helped!!

3 0

3 years ago

Cell division occurs in which layer of the skin milady

vladimir2022 [97]

Mitosis and cytokinesis. In eukaryotes the processes of DNA replication and cell division occur at different times of the cell division cycle. During cell division, DNA condenses to form short, tightly coiled, rodlike chromosomes. Each chromosome then splits longitudinally, forming two identical chromatids.

3 0

3 years ago

Which compounds present in insects are composed of the amino acids that provide the Venus flytrap and sundew with much of their

Fudgin [204]

I believe it is Protein

3 0

3 years ago