1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timofeeve [1]
3 years ago
5

Need mRNA AMINO ACIDS 1.AATACGGGGGCGTAACCACTA 2. GCTAGTACGTGCACATTAGAA

Biology
1 answer:
vovangra [49]3 years ago
4 0

Answer:

1.AATACGGGGGCGTAACCACTA

mRNA: UUAUGCCCCCGCAUUGGUGAU

Amino Acid: Leu, Cys, Pro, Arg, Ile, Gly, Asp

2.GCTAGTACGTGCACATTAGAA

mRNA: CGAUCAUGCACGUGUAAUCUU

Amino Acid: Arg, Ser, Cys, Thr, Cys, Ans, Leu

Explanation:

I abbriviated the amino acids.  If you ever need to find the mRNA of DNA, apply the smae rules to the mRNA but A goes with U.  

RNA : Replace Thymine (T) with Uracil (U)

To find amino acids:  Use an mRNA codon

You might be interested in
Which process in living things removes oxygen from the oxygen cycle
tamaranim1 [39]

I believe the answer is decomposition. please let me know if that is correct.

3 0
3 years ago
Read 2 more answers
The process that Mildred used is known as _______. radiocarbon dating faulting indexing superposition
snow_tiger [21]
<em />It's radiocarbon dating because in the previous question it says that she is trying to find the amount of carbon-14 and carbon-12 in the fossil
8 0
3 years ago
Read 2 more answers
You are ready to give a patient a bed bath. he is complaining of pain you should:
vladimir1956 [14]
I think it’s option a.
4 0
3 years ago
Choose all the answers that apply.
Svetllana [295]

Answer:

CO2 is a compound, it has 2 atoms of oxygen, and is made up of oxygen and carbon

Explanation:

6 0
3 years ago
What is the sugar found in DNA that makes up the sugar-phosphate backbone of the double helix?
Georgia [21]

Answer:

deoxyribose

Explanation:

A phosphate backbone is the portion of the DNA double helix that provides structural support to the molecule. DNA consists of two strands that wind around each other like a twisted ladder. Each strand has a backbone made of alternating sugar (deoxyribose) and phosphate groups.

I hope that this helped you ;)

8 0
3 years ago
Other questions:
  • Show the possible genotypes and phenotypes of the offspring from a cross between a heterozygous male with type A blood and a het
    6·1 answer
  • 2. what ethical considerations will arise if this research is pursued?
    11·1 answer
  • How does interphase prepare a cell to divivde?
    9·1 answer
  • A medical student makes a frontal cut of a cadaver's abdomen. The two new sections of the abdomen could be referred to as the?
    11·2 answers
  • What type of isolation occurs when species are spread too far out over an area?
    14·1 answer
  • The correct sequence between genes and their phenotypic expression is
    5·1 answer
  • What happens to the cell membrane that the result is two daughter cells
    8·1 answer
  • A net force of 2,500 N acts on an elephant with a mass of 7,000 kg. How
    9·1 answer
  • Classify each substance based on the intermolecular forces present in that substance.
    6·1 answer
  • Valve that prevents backflow of blood into the left ventricle and creates the second, dubb sound.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!