1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timofeeve [1]
3 years ago
5

Need mRNA AMINO ACIDS 1.AATACGGGGGCGTAACCACTA 2. GCTAGTACGTGCACATTAGAA

Biology
1 answer:
vovangra [49]3 years ago
4 0

Answer:

1.AATACGGGGGCGTAACCACTA

mRNA: UUAUGCCCCCGCAUUGGUGAU

Amino Acid: Leu, Cys, Pro, Arg, Ile, Gly, Asp

2.GCTAGTACGTGCACATTAGAA

mRNA: CGAUCAUGCACGUGUAAUCUU

Amino Acid: Arg, Ser, Cys, Thr, Cys, Ans, Leu

Explanation:

I abbriviated the amino acids.  If you ever need to find the mRNA of DNA, apply the smae rules to the mRNA but A goes with U.  

RNA : Replace Thymine (T) with Uracil (U)

To find amino acids:  Use an mRNA codon

You might be interested in
Describe the carbon atom:
Tamiku [17]
A sole carbon particle: The degradation of particulate organic matter in the ocean is a central process in the global carbon cycle, the mode and tempo of which is determined by the bacterial communities that assemble on particle surfaces.
5 0
3 years ago
Read 2 more answers
Which muscles assist in inhalation when running up the stairs? A) sternocleidomastoid, pectoralis major, scalenes B) sternocleid
Ulleksa [173]

Answer:

Sternocleidomastoid, pectoralis minor, scalenes

Explanation:

During normal inhalation, contraction of the diaphragm and the contraction of external intercostals expands the chest cavity. The increased volume of the thoracic cavity results in reduced alveolar pressure than the atmospheric pressure to facilitate the flow of air into the lungs in response to the pressure gradient.

During deep inhalation as it occurs when running up the stairs, the accessory muscles of inhalation also participate to increase the volume of the chest cavity. The contraction of scalene and sternocleidomastoid muscles increase the volume of the chest cavity further to create a greater drop in alveolar pressure.

During forceful inhalation, the sternocleidomastoid muscles serve to elevate the sternum, the scalene muscles serve to elevate the first two ribs while the pectoralis minor elevate the third through fifth ribs.

7 0
3 years ago
Read 2 more answers
The worm population will . . .
jarptica [38.1K]

Answer:

Die in a few years

Explanation:

What? I’m being realistic!

3 0
3 years ago
Read 2 more answers
People can have the rhinovirus more than once because __________. they have no while blood cells it hides then re-attacks later
Anettt [7]
There are many types of the virus
3 0
3 years ago
Read 2 more answers
Plz help I will mark you brainlist plz is it 1,2, or 3​
Vinil7 [7]
The first image is the answer.
5 0
3 years ago
Other questions:
  • I need help with this
    10·1 answer
  • What are the similarities between the immortal jellyfish and wolf
    7·1 answer
  • Where is the carbon taken in by plants during photosynthesis stored?
    5·1 answer
  • A research group involved with advertising is conducting a study to investigate whether shoppers are more likely to engage in im
    11·1 answer
  • Which statement is true about the appendicular skeleton of the human body?
    14·1 answer
  • Which of the following is a way that bacteria cause disease?
    7·1 answer
  • In order for DNA to replicate, the strand must separate at which of the following locations?
    14·1 answer
  • Do both plant cells and prokaryotic cells have 70S ribosomes ​
    8·1 answer
  • Which of the following statements about planetary satellites is true?
    9·1 answer
  • Which statement is best supported by the data in the graph?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!