1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timofeeve [1]
2 years ago
5

Need mRNA AMINO ACIDS 1.AATACGGGGGCGTAACCACTA 2. GCTAGTACGTGCACATTAGAA

Biology
1 answer:
vovangra [49]2 years ago
4 0

Answer:

1.AATACGGGGGCGTAACCACTA

mRNA: UUAUGCCCCCGCAUUGGUGAU

Amino Acid: Leu, Cys, Pro, Arg, Ile, Gly, Asp

2.GCTAGTACGTGCACATTAGAA

mRNA: CGAUCAUGCACGUGUAAUCUU

Amino Acid: Arg, Ser, Cys, Thr, Cys, Ans, Leu

Explanation:

I abbriviated the amino acids.  If you ever need to find the mRNA of DNA, apply the smae rules to the mRNA but A goes with U.  

RNA : Replace Thymine (T) with Uracil (U)

To find amino acids:  Use an mRNA codon

You might be interested in
A person with a phenotype of HbSS has sickle cell disease. A person with a phenotype of HbAS allele carries the sickle cell trai
makkiz [27]

The right answer is 1/4.

Two carriers of the disease each have a chance in two to transmit their sick gene ie: 1/2 * 1/2 = 1/4

A genetic disease is said to be autosomal recessive when

The gene involved is carried by an autosome (non-sex chromosome, X or Y in XY system of sexual determination);

The associated phenotype of this trait is recessive (the presence of two identical alleles is essential for the character to be expressed).

One of the two alleles is transmitted by the male gamete, the other by the female gamete.

But being a carrier of the mutation does not necessarily mean being sick, the manifestations of a genetic disease depend on its penetrance and the variability of its expression.

3 0
3 years ago
What kind of protist causes dysentery? asap plz
Mars2501 [29]
<span>Entameba hystolytica is dysentery causing protist.</span>
7 0
3 years ago
Read 2 more answers
What are three major differences between rna and dna?
stellarik [79]
1. DNA is double stranded, while RNA is single stranded

2. DNA contains the sugar deoxyribose; while RNA containers the sugar ribose

3. The four nitrogenous bases that are a part of DNA are guanine, cytosine, adenine, and thymine; in RNA, the four nitrogenous bases are guanine, cytosine, adenine, and uracil (the uracil in RNA replaces the thymine in DNA)

Hope this helps :)
8 0
3 years ago
Scientists study layers of glaciers to determine climate from many years ago?
nika2105 [10]

Answer:

b

Explanation:

7 0
2 years ago
The ability to work with the sick and the infirm depends on one's ability and willingness to show ________. select one: a. empat
sveta [45]

The ability to work with the sick and the infirm depends on one's ability and willingness to show Empathy.

Option A is correct .

What is empathy ?

Empathy, the ability to understand and share the feelings of another, is an important asset to improve health outcomes for patients with LHL. Empathy is much more than just knowing a patient’s medical history, symptoms, or signs of disease and goes far beyond clinical diagnosis and treatment. It is the ability to truly understand the patients’ emotions, fears, pain and worry and the ability to respond to these.

The term “empathy” is used to describe a wide range of experiences. Emotion researchers generally define empathy as the ability to sense other people's emotions, coupled with the ability to imagine what someone else might be thinking or feeling.

Learn more about empathy :

brainly.com/question/15287960

#SPJ4

6 0
1 year ago
Other questions:
  • Which type of stress causes deformation that leads to earthquakes at converging plate boundaries
    8·1 answer
  • Which sequence describes the order of structures through which air travels in the bird respiratory system? trachea, lung, anteri
    5·1 answer
  • Study the agencies and policies above concerning environmental policies. You are part of a group of concerned citizens which is
    15·2 answers
  • DNA translates the information in RNA to make proteins
    7·2 answers
  • How many sets of chromosomes do diploid organisms have?
    5·1 answer
  • What happens when the cloud becomes heavy?
    6·2 answers
  • Please help will mark brainliest !!!
    9·2 answers
  • 8. Which of the following organ systems function like a cell membrane in animal cells
    15·2 answers
  • PLSS HELP! Earths layers are crust,____ and _____ (inner and outer)
    13·2 answers
  • Please help me please
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!