1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timofeeve [1]
2 years ago
5

Need mRNA AMINO ACIDS 1.AATACGGGGGCGTAACCACTA 2. GCTAGTACGTGCACATTAGAA

Biology
1 answer:
vovangra [49]2 years ago
4 0

Answer:

1.AATACGGGGGCGTAACCACTA

mRNA: UUAUGCCCCCGCAUUGGUGAU

Amino Acid: Leu, Cys, Pro, Arg, Ile, Gly, Asp

2.GCTAGTACGTGCACATTAGAA

mRNA: CGAUCAUGCACGUGUAAUCUU

Amino Acid: Arg, Ser, Cys, Thr, Cys, Ans, Leu

Explanation:

I abbriviated the amino acids.  If you ever need to find the mRNA of DNA, apply the smae rules to the mRNA but A goes with U.  

RNA : Replace Thymine (T) with Uracil (U)

To find amino acids:  Use an mRNA codon

You might be interested in
Let us assume that the following protein (Met-Lys-Phe-Ser) changes the pigment deposited in the skin to a tan color. Would this
Leokris [45]
This is beneficial and is actually an adaptation of humans to climates with larger amounts of sunshine. The darker color of skin helps prevent damage such as sun burn.
8 0
3 years ago
Read 2 more answers
When it is summer at the South Pole
Minchanka [31]
When the sun is above the horizon and when the sun is below the horizon it is winter 
5 0
3 years ago
Read 2 more answers
Which best describes plant classification?
mario62 [17]
If the question goes like this: Which best describes plant classification? <span><span>
A.      </span>Nonvascular plants are grouped into seedless and seeded plants. </span> <span><span>
B.      </span> Seedless plants are grouped into gymnosperms and angiosperms.</span> <span><span>
C.      </span>Gymnosperms are grouped into monocots and dicots. </span> <span><span>
D.      </span> Angiosperms are grouped into monocots and dicots.</span>   <span>

The best answer will be letter D. Angiosperms are grouped into monocots and dicots.</span>     Botanists grouped or classified together according to its characteristics.

see attached file for more information about classification of plants.


Download docx
6 0
3 years ago
Salt is made up of a atom of sodium and a atom of chlorine. True or False
givi [52]
The statement is true. This is because the chemical formula for a salt compound (a compound is made up of two or more atoms of elements) is NaCl, where Na is Sodium, and Cl is Chlorine. Hope this helps!
4 0
3 years ago
How will agents of weathering such as wind and water most likely affect this landscape
Alika [10]

Answer:

Answer

Explanation:

The wind and water can break down the landscape and affect its physical formation. Water for example can break down rocks and make a ditch from 1 foot deep to 6 feet deep.

4 0
3 years ago
Other questions:
  • What albedo has to do with arctic sea ice melt.​
    8·1 answer
  • Which type of cell does not contain a nucleus enabling it to carry more hemoglobin? leucocyte white blood cell nerve Cell erythr
    14·1 answer
  • Scientific investigations often lead to the formulation of new scientific questions. The observations Charles Darwin made during
    6·2 answers
  • "Slab pull" is a type of tectonic plate movement that occurs due to the forces of mantle convection and results in the subductio
    13·1 answer
  • obeys the 2nd "breaks down starch releasing 100 kcal of energy" It then uses this energy to synthesize and store 100 kcal of fat
    7·1 answer
  • What specific amino acid difference did you discover between normal and sickle-cell betaglobin?
    10·1 answer
  • Which of the following is an example of microevolution?
    7·1 answer
  • What makes it possible for the plant to grow from the bricks
    7·1 answer
  • What is the water table?
    12·1 answer
  • true or false Carbohydrate-rich sports drinks should not be given to athletes during endurance sport participation because blood
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!