1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timofeeve [1]
3 years ago
5

Need mRNA AMINO ACIDS 1.AATACGGGGGCGTAACCACTA 2. GCTAGTACGTGCACATTAGAA

Biology
1 answer:
vovangra [49]3 years ago
4 0

Answer:

1.AATACGGGGGCGTAACCACTA

mRNA: UUAUGCCCCCGCAUUGGUGAU

Amino Acid: Leu, Cys, Pro, Arg, Ile, Gly, Asp

2.GCTAGTACGTGCACATTAGAA

mRNA: CGAUCAUGCACGUGUAAUCUU

Amino Acid: Arg, Ser, Cys, Thr, Cys, Ans, Leu

Explanation:

I abbriviated the amino acids.  If you ever need to find the mRNA of DNA, apply the smae rules to the mRNA but A goes with U.  

RNA : Replace Thymine (T) with Uracil (U)

To find amino acids:  Use an mRNA codon

You might be interested in
How is genetic information carried from one organism to its offspring?
Vika [28.1K]

Answer:

DNA

Explanation:

how does hereditary work?

7 0
3 years ago
Which of the following statement(s) is/are true regarding the adrenal glands' relationship with the autonomic nervous system?
Studentka2010 [4]

Answer:

The true statements regarding the adrenal glands' relationship with the autonomic nervous system are:

a. The adrenal cortex is an extension of the parasympathetic nervous system.

c. The adrenal glands are strictly nerve tissue.

d. The parasympathetic division stimulates the adrenal cortex to secrete glucocorticoids.

e. The adrenal medulla is penetrated by the fibers of the sympathetic nervous system.

Explanation:

The  levels of the central nervous system which play important roles in influencing the autonomic nervous system include cerebral cortex, hypothalamus, brain stem, and spinal cord.  Usually, epinephrine (adrenaline) and norepinephrine are released into the blood stem when stress or a threat occurs.  This alert serves as a warning signal and defense system.  The purpose is to maintain homeostasis.

4 0
3 years ago
Which type of volcano forms over hotspots
Readme [11.4K]
Hawaii are the more hotspots area of volcanos. occurs in the type of temperature
3 0
3 years ago
Cameron performed a virtual lab on plant transpiration to determine the rates of environmental conditions; ranking them from the
IrinaVladis [17]

Answer:

C.)  Warm, Windy, Normal, and Humid

Explanation:

4 0
3 years ago
How many food calories can a human burn up in an hour by exercising at this rate? (remember that only 20.0 % of the food energy
blsea [12.9K]

Human can produce a maximum mechanical power of 1/3 hp (horse-power).

Horse power is a unit of power, it equals 746 watt (watt is also a power unit, known to be equal to a joule per second)


So:

1 ph = 746 watt = 746 J/s

1/3 ph = 248.6 J/s

we're looking for the calories, so

1 joule = 0.239006 calories


So human produce a maximum mechanical power of:

248.6 J/s = 82.88 calories per second.


We're looking for the number of calories consumed in three hours, so:

82.88 cal/s = 82.88 cal/s * 3600 s * 3 = 895200 calories = 895.2 kilocalories (food calories).


The number of food calories is 895.2 food calories

4 0
4 years ago
Other questions:
  • What is the difference between prokaryotic and eukaryotic cells?
    14·2 answers
  • Trees that have thick waxy needles to prevent water loss and protect from cold would most likely be found in which biome?
    8·2 answers
  • In small groups – as opposed to large ones – individuals are
    5·1 answer
  • The ______________ of the cerebral cortex are not involved in primary motor or sensory functions; rather, they are involved in l
    5·1 answer
  • Women have a smaller quantity of the enzyme ____, which breaks down alcohol.​
    14·1 answer
  • Jimmy and Joanna were walking in their backyard and noticed a mushroom growing on the outside of a dead tree. Jimmy claimed that
    7·2 answers
  • How much coal will be produced in the year 2020 for EACH region
    5·2 answers
  • The pectoral girdle includes the_____
    11·1 answer
  • An enzyme is a protein that-A. increases the rate of a chemical reaction
    13·1 answer
  • What is the net charge of the structure in the figure below<br><br> answer with proof for brainliest
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!