All categories

2 years ago

Need mRNA AMINO ACIDS 1.AATACGGGGGCGTAACCACTA 2. GCTAGTACGTGCACATTAGAA

Biology

1 answer:

vovangra [49]2 years ago

4 0

Answer:

1.AATACGGGGGCGTAACCACTA

mRNA: UUAUGCCCCCGCAUUGGUGAU

Amino Acid: Leu, Cys, Pro, Arg, Ile, Gly, Asp

2.GCTAGTACGTGCACATTAGAA

mRNA: CGAUCAUGCACGUGUAAUCUU

Amino Acid: Arg, Ser, Cys, Thr, Cys, Ans, Leu

Explanation:

I abbriviated the amino acids. If you ever need to find the mRNA of DNA, apply the smae rules to the mRNA but A goes with U.

RNA : Replace Thymine (T) with Uracil (U)

To find amino acids: Use an mRNA codon

You might be interested in

Which of the following is not true concerning the Pleistocene ice age.

alina1380 [7]

I believe the answer to this question is D, I am not sure though.

3 0

3 years ago

Read 2 more answers

If you flip a penny 99 times and each time it came up heads then the chance of the penny coming up heads is ___

Helga [31]

The chances of heads as a result when flipping a penny will always be 50%. Although heads came up 99 times in a row, the events that occurred before will not affect the probability of the current event in terms of a coin flip.

There are 1 out of 2 chances of it occurring or 1/2. Divide that and multiply it by 100% to get the probability in percent. So the answer will be 50%.

The answer is B.

5 0

3 years ago

Which one(s) contribute the most to the mass of a plant? I. Soil II. Carbon III.Water A) I only B) II only C) I and III only D)

allochka39001 [22]

<span>D) II and III only is what i would put</span>

5 0

3 years ago

Read 2 more answers

An important challenge to traditional (pre-1860) ideas about species was the observation that seemingly dissimilar organisms, su

choli [55]

Answer:

these seemingly dissimilar organisms might have evolved from a distant

Explanation:

Evolution deals with history of organism survival on Earth.

The evolutionary biologists makes use of fossils as proves to give light to having a clear view of how species survived in past times.

Before the theory of natural selection by Charles Darwin, Evolutionary Biologists were filled with questions about why the type of skeletal structural specimens collected were equal and different in dissimilar organisms as it does not exhibit the links seen between these species.

The theory of evolution proposed the mechanism of divergent evolution as a solution to these questions.

Therefore, we conclude that "these seemingly dissimilar organisms might have evolved from a distant" is the right answer.

5 0

3 years ago

What sorts of adaptations do prey have for avoiding predators?.

e-lub [12.9K]

Answer:

adaptations such as warning coloration, alarm calls and other signals, camouflage, mimicry of well-defended species, and defensive spines and chemicals.

Hope this helps with whatever you are working on :)

Explanation:

8 0

2 years ago

Read 2 more answers