1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksi-84 [34.3K]
4 years ago
10

When the centromeres split in mitosis,what does the sister chromatids’ name change to?

Biology
1 answer:
snow_lady [41]4 years ago
5 0

Answer:

During anaphase 2, the chromosomes' centromeres break, and the spindle fibers pull the chromatids apart. The two split portions of the cells are officially known as "sister chromosomes" at this point.

Explanation:

You might be interested in
How do plate tectonics support evolution?
Amanda [17]
Plate tectonic processes such as the redistribution of continents, growth of mountain ranges, formation of land bridges, and opening and closing of oceans provide a continuous but moderate environmental pressure that stimulates populations to adapt and evolve.
3 0
3 years ago
Long-term evolution between bats and moths can lead to coevolution. Coevolution occurs when two species evolve in response to th
Sonja [21]

In this case, the two species have coevolved by modifying behavioral traits (moths) and physiological traits (bats).

<h3>What is coevolution?</h3>

Coevolution is a particular type of evolution where a selective pressure imposed by one species serves to generate an adaptive change in another species and vice-versa.

Coevolution is fundamental in predator-prey relationships and leads to the emergence of new traits that are selected by natural selection.

In conclusion, the two species above have coevolved by modifying behavioral traits (moths) and physiological traits (bats).

Learn more about coevolution here:

brainly.com/question/1489642

#SPJ1

3 0
2 years ago
Elaborate on the reason that "cola" type drinks are used to make effective marinades.
Vlad [161]
I think its b............
3 0
4 years ago
Read 2 more answers
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Which sign best represents the role of decomposers?
Nuetrik [128]

Answer:

B

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • What was the greatest stumbling block for scientists understanding of the star at the Sun?
    13·1 answer
  • Which of the following statements about the left ventricle is/are true? A. Blood entering the left ventricle is usually quite lo
    12·1 answer
  • In 1771, joseph priestly conducted an experiment where he put a living mint spring into a glass container with a lit candle. thi
    5·1 answer
  • Who created the first accepted model of the atom?
    9·1 answer
  • Which correctly identifies the composition of an oxygen atom ?
    10·1 answer
  • How many genetic disorders are known
    11·2 answers
  • Temperature regulation occurs in the hypothalamus. Normally, when the body temperature increases the body will respond by causin
    8·1 answer
  • Will try to give brainliest PLEASE HELP ASAP
    10·2 answers
  • Theophrastus was considered the father of botany in the approximately year
    9·2 answers
  • What was unusual about Tribrachidum?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!