1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eduardwww [97]
3 years ago
8

Ccording to Sir Isaac Newton, gravity depends on two factors. What are they?

Biology
1 answer:
KiRa [710]3 years ago
4 0

Answer:

Mass and distance.

Explanation:

Gravity is considered to be a universal force of attraction which acts between all objects that has both mass, energy and occupy space. Therefore, it acts in such a way as to bring objects together.

Additionally, the gravity of earth makes it possible for all physical objects to possess weight.

Newton's law of universal gravitation states that the force of attraction (gravity) acting between the Earth and all physical objects is directly proportional to the Earth's mass, directly proportional to the physical object's mass and inversely proportional to the square of the distance separating the Earth's center and that physical object.

According to Sir Isaac Newton, gravity depends on two factors and these are mass and distance.

You might be interested in
Please answer these questions using this video: https://youtu.be/kuFODX4VuAw
trapecia [35]
The link is not working
4 0
3 years ago
Zirconium has an atomic number of 40 and an atomic mass of 91. How many neutrons does it have?
Natali [406]
Subtract the atomic number from the atomic mass to get the neutrons 
7 0
2 years ago
Which equation represents the balanced equation for photosynthesis?
Sever21 [200]
Is there a picture or do you want me to explain
3 0
2 years ago
Read 2 more answers
Which structures in diagram 1 and diagram 2 carry out similar life functions
VashaNatasha [74]

Answer:

My guess is A

Explanation:

I guess it's a but dont choose it it might not be right

3 0
2 years ago
What is a nerve’s long threadlike bundle that conducts electrical impulses?
Reil [10]

Answer:

A nerve is actually a long threadlike bundle of dendrites that conduct electrical impulses. Dendrite word derived from the Greek word 'dendron' which means tree. They carry messages in the form of electrical impulses to cell body, there are also wire like nerves called axon.

Explanation:

Hope it helps you

have a good day dear friend

5 0
3 years ago
Other questions:
  • ____: cells lacking a nucleus and other membranes bound organelles
    8·2 answers
  • When a sperm and an egg unite, a _________________ is formed?
    10·1 answer
  • What is the medical term for the ventral fold of tissue that attaches the foreskin to the glans?
    8·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A parrot learns that every time it says “Pretty Please” its owner gives it a piece of fruit. What is this an example of?
    10·2 answers
  • How does the heart work
    9·1 answer
  • Help please!! I'll name you brainliest!!
    6·1 answer
  • PLS HELP questions are in the picture!!
    10·1 answer
  • No mate repaired a.asexual reproduction b.sexual reproduction c.both
    11·2 answers
  • Can someone help me plz asap? I am giving brainliest.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!