1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
USPshnik [31]
3 years ago
9

Which benefits do mangrove trees provide to surrounding coastal wetlands? Check all that apply.

Biology
1 answer:
padilas [110]3 years ago
7 0

Answer:

1, 2, and 4

Explanation:

1. They hold the soil in place because of their tangled root infrastructure

2. They safeguard the shores from storms, floods

4. They sustain the clarity and quality of water, trapping the sediments and filtering pollutants arising from the land

You might be interested in
What colonial power was responsible for the creation of the wildlife reserves that served as the basis for modern-day Serengeti
olchik [2.2K]

Answer:

Answer is United Kingdom or Britain.

Explanation:

The Serengeti national park is located in Tanzania, and it was carved out of a plain area, known as Serengeti.

It was reported that the residents of where the Serengeti national park is now  located, were driven out  and moved to another place. This act was carried out in 1959 by the British.

Serengeti national park was famously known for annual migration of Wildebeest and Zebra.  

3 0
3 years ago
5. Shira looked up one night and saw a full moon. How long will it be before she can see a full moon
Rashid [163]

Answer:

About one week

Explanation:

6 0
3 years ago
Read 2 more answers
Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
topjm [15]

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

3 0
3 years ago
a double blind study is one in which neither the researchers nor the subjects know who is receiving the placebo why are studies
djyliett [7]

The studies are designed this way b/c it removes the power of suggestion and the double-blind study keeps both researchers and participants in the dark. So this compared to who is receiving the treatment which is relevant b/c it stops the researchers from accidentally overbalancing the study participants, or unintentionally favoring their assessment of the conclusions.

4 0
3 years ago
Which of the following genetic disorders is described by the following:
Likurg_2 [28]

Answer:

Achondroplasia

Explanation:

Achondroplasia is a genetic disorder that comes from the inability to change cartilage into bone, especially in long bone. The characteristic of the disease is short stature, large head, vertebral abnormalities, and many other possible symptoms. It's inherited genetically by a dominant pattern, but most cases come from a mutation from a parent that has no defect gene. It is the most common cause of dwarfism.

3 0
4 years ago
Other questions:
  • Why copper is much more expensive than iron?
    9·2 answers
  • In what vessel is blood pressure the highest?
    7·1 answer
  • 5 points
    8·1 answer
  • Mr. Stein builds a model of a molecule out of wooden beads and pegs. He uses the model to explain the shape of the molecule. Mr.
    15·1 answer
  • In what ways is the atmosphere of the earth different from the gaseous consistency of the early universe
    6·1 answer
  • What is the meaning of abs?
    10·2 answers
  • Which zpe virus is most
    13·1 answer
  • A population of deer mice lives in a neighborhood. Which of these changes to
    14·2 answers
  • Los modelos atómicos que se están comparando son
    5·1 answer
  • Which molecule is metabolized in a cell to produce energy currency
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!