1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Flauer [41]
3 years ago
13

Water enters the atmosphere from plants through a process called Evapor

Biology
1 answer:
romanna [79]3 years ago
5 0

Answer:

evaporation

Explanation:

You might be interested in
Which of the following products are derived from invertebrates? food shell jewelry silk cottonshell products are derived from in
Elden [556K]
SHELL products are derived from invertebrates.
3 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
PLSSS HELP WITH THIS IMMEDIATELY!!!!! only answer if u know, i’ll be giving brainiest to the right answert
s344n2d4d5 [400]

Answer:

I cant see the question just use the snipping tool to tack a screenshot

Explanation:

8 0
2 years ago
You arrive at the scene of a Motor Vehicle Accident. You find three patients, a 16 year old boy with a broken arm, a seventeen y
mamaluj [8]

Answer: 17 year old

Explanation:

8 0
3 years ago
Read 2 more answers
What is catalase and where is it found in living organisms?
adell [148]
Catalase<span> is a common enzyme </span>found<span> in nearly all </span>living organisms<span> exposed to oxygen</span>
6 0
2 years ago
Other questions:
  • What is a fossil and how can they be used to help unveil earth’s history
    12·1 answer
  • Dna replication results in two dna molecules
    14·1 answer
  • The attraction between hydrogen and oxygen atoms in different water molecules is known as a(n)
    14·1 answer
  • How does an autotroph get its food
    13·1 answer
  • When you do rigorous exercise, the cells of the muscles require more oxygen. Which condition ensures this requirement is met?
    11·1 answer
  • Why do animals breathe more heavily when exercising?
    9·1 answer
  • In which state of matter are particles most distant from one another
    8·2 answers
  • Are Parakeets good starter pets? why or why not
    8·1 answer
  • Which plant would have an advantage in getting pollinated?
    7·1 answer
  • 10. Which type of graph is the best to show the relationship between an Independent Variable (IV) and a Dependent Variable (DV)?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!