1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bazaltina [42]
3 years ago
5

Identify three ways that bacteria can be transferred from person to person.

Biology
1 answer:
alexdok [17]3 years ago
6 0

Answer:

Bacteria may spread directly from one person to another. For example, they can spread through touching, coughing, or sneezing. They may also spread via food, water, or objects. Another way bacteria and other pathogens can spread by vectors.

(touching, coughing, or sneezing)

Explanation:

Hope this helps!!!

You might be interested in
Is there likely to be a major earthquake -- 7 or above on the Richter scale -- in Brooklyn?
Ray Of Light [21]

Answer:

Not likely to be one that high.

Explanation:

A 7 only every 3,400 years so not likely.

7 0
3 years ago
The two main phases of the cell cycle are the cytokinetic phase and interphase
Vitek1552 [10]

Answer:

Flase

Explanation:

The cell cycle has two major phases: interphase and the mitotic phase. During interphase, the cell grows and DNA is replicated. Usually the cell will divide after mitosis in a process called cytokinetic in which the cytoplasm is divided and two daughter cells are formed.

hope this helps

have a great day/night :)

4 0
3 years ago
Read 2 more answers
What is the difference between photosynthesis, chlorophyll, thylakoids and chloroplasts
AleksAgata [21]
Chloroplasts capture light energy. Thylakoids can be found inside chloroplasts, where light-dependent reactions occur. ... Chlorophyll absorbs light energy. Chlorophyll is what makes plants look green
3 0
3 years ago
What is the mRNA that would be transcribed from this strand of DNA?
Illusion [34]

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

8 0
2 years ago
Which of the following is a method of preventing pests from damaging your crops?
GalinKa [24]

b) introducing biological predators eg to kill mice in rice field snake can be used

8 0
3 years ago
Other questions:
  • The replacement of defective genes with healthy genes to treat disease is called _________.
    12·1 answer
  • What is an example of environmental pressure
    14·1 answer
  • Which list shows the correct sequence of steps in the transcription process? (brainliest)
    13·2 answers
  • How does nearsightedness different from farsightedness?
    8·2 answers
  • Each photo shows an example of weathering and erosion. Match each photo with the element that caused the weathering and erosion?
    13·2 answers
  • The interactions of earthworms and robins in a beech forest make up which ecological unit? A. population B. ecosystem C. biome D
    13·2 answers
  • Joint movement occurs around an axis that is always ____ to its plane.
    7·1 answer
  • Give your own position on xenophobia in South Africa​
    5·1 answer
  • You can only use each organ only once ​
    12·1 answer
  • Which of the structures are considered accessory organs in the digestive system?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!