1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkasestr [34]
2 years ago
11

Describe How does cystic fibrosis affect homeostasis?

Biology
1 answer:
mina [271]2 years ago
7 0

Answer:

In CF, these homeostatic mechanisms are impaired, leading to a dehydrated and acidic ASL. ASL volume depletion in CF is secondary to defective anion transport by the abnormal cystic fibrosis transmembrane conductance regulator protein (CFTR).

Explanation:

#(✯ᴗ✯)I hope it's help

You might be interested in
Select all that apply. For the photosynthesis process to occur, a plant needs _____. sunlight chlorophyll nitrogen carbon dioxid
Volgvan
The answer is sunlight, chlorophyll, carbon dioxide and water.

In the photosynthesis plants use sunlight as an energy and convert it into chemical energy stored in carbohydrates. Carbon dioxide and water are used for carbohydrate synthesis. This process occurs in the chloroplasts containing chlorophyll, which is necessary for absorbing energy from sunlight. 
5 0
3 years ago
What kind of matter is formed when atoms of two or more elements bond?
tresset_1 [31]
Molecules are formed. 
This question belongs in chemistry. 
7 0
3 years ago
EVEN MORE POINTS, again I luv all of you and hope you all have a great day.
siniylev [52]

Answer:

oooh moneys

Explanation:

8 0
3 years ago
Read 2 more answers
1. If you were the size of a cell what would you do & why?
devlian [24]

Answer:

Make more cells

Explanation:

4 0
3 years ago
The synaptonemal complex is Group of answer choices a network of microtubules that forms the spindle apparatus. a region of high
DerKrebs [107]

Answer:

a network of proteins that holds homologues together.

Explanation:

Genetics can be defined as the scientific study of hereditary in living organisms such as humans, animals and plants.

The synaptonemal complex is a network of proteins that holds homologues (homologous chromosomes) together.

Generally, a synaptonemal complex (protein lattice) is formed between homologous chromosomes during mitosis and meiosis. Also, synaptonemal complex is important for the formation of the four sister chromatids referred to as tetrads.

Furthermore, the synaptonemal complex (protein lattice) has a tripartite structure which comprises of the following components;

I. SC protein-1 (SYCP1).

II. SC protein-2 (SYCP2).

III. SC protein-3 (SYCP3).

In conclusion, the synaptonemal complex plays a significant role in synapsis, recombination and chromosome pairing.

8 0
3 years ago
Other questions:
  • A species that is no longer in existence would best be characterized as which of the following?
    13·1 answer
  • Among animals, both oviparity and amniotic eggs can be found in: (select all that apply.) reptiles. birds. insects. amphibians.
    7·2 answers
  • Someone please answer these for me:) :
    9·1 answer
  • Which one of these organs is not found in the excretory system?
    11·2 answers
  • Explain the statement: the energy for all organisms in a food web can be traced back to the son. Note: do not write “the sun is
    14·1 answer
  • 16. What are the substances that constitute the chromatin? What is the difference between chromatin and chromosome?
    14·1 answer
  • Egg whites stiffen when they are whipped. The change that occurs in the protein is called ___________.a. denaturation. b. transl
    8·2 answers
  • The total magnification of a specimen viewed under a compound light microscope is determined by
    9·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • 100 POINTS AND BRAINLIEST!! ONLY IF YOU GET IT CORRECT!!
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!